Rh4BG248600

Paired amphipathic helix protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
41638898 .. 41660767
21870 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG248600.1

Sequence Viewer

Length: 180 bp
ATGCAGCGTTTTCCACACAAACAGAAATCCACTCATAGGAGTGAAGACTTAGCTGCTGACCAATTGCATCAAGGTGGGGAAGACGATGAAAGCCTGGGAGAACATCTCATTTCATCTTCTCATGACGATAAAAATTCTGCAAAAAAGTTGAGAGTGATGATTATTTCCTGTGATCCTTGA

Protein Analysis

59

Amino Acids

6.66

Weight (kDa)

5.87

Isoelectric Point (pI)

52.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 167
AcsI RAATTY 1 cut(s) 133
AfiI CCNNNNNNNGG 1 cut(s) 36
AjnI CCWGG 1 cut(s) 93
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
AlwI GGATC 1 cut(s) 167
ApeKI GCWGC 2 cut(s) 4, 53
ApoI RAATTY 1 cut(s) 133
BbsI GAAGAC 2 cut(s) 51, 87
BbvI GCAGC 2 cut(s) 16, 40
BciT130I CCWGG 1 cut(s) 95
BisI GCNGC 2 cut(s) 5, 54
BlsI GCNGC 2 cut(s) 6, 55
Bme1390I CCNGG 1 cut(s) 95
BmrFI CCNGG 1 cut(s) 95
BmsI GCATC 1 cut(s) 76
BpiI GAAGAC 2 cut(s) 51, 87
BplI GAGNNNNNCTC 2 cut(s) 90, 122
BsaJI CCNNGG 1 cut(s) 94
Bsc4I CCNNNNNNNGG 1 cut(s) 36
BseBI CCWGG 1 cut(s) 95
BseDI CCNNGG 1 cut(s) 94
BseLI CCNNNNNNNGG 1 cut(s) 36
BseXI GCAGC 2 cut(s) 16, 40
BslI CCNNNNNNNGG 1 cut(s) 36
Bsp143I GATC 1 cut(s) 172
BspHI TCATGA 1 cut(s) 121
BspPI GGATC 1 cut(s) 167
BssECI CCNNGG 1 cut(s) 94
BssMI GATC 1 cut(s) 172
Bst2UI CCWGG 1 cut(s) 95
BstDEI CTNAG 1 cut(s) 49
BstKTI GATC 1 cut(s) 175
BstMBI GATC 1 cut(s) 172
BstNI CCWGG 1 cut(s) 95
BstSCI CCNGG 1 cut(s) 93
BstV1I GCAGC 2 cut(s) 16, 40
BstV2I GAAGAC 2 cut(s) 51, 87
CciI TCATGA 1 cut(s) 121
CviAII CATG 1 cut(s) 122
CviJI RGCY 2 cut(s) 53, 93
CviKI_1 RGCY 2 cut(s) 53, 93
DdeI CTNAG 1 cut(s) 49
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
EcoRII CCWGG 1 cut(s) 93
FaeI CATG 1 cut(s) 125
FaiI YATR 2 cut(s) 36, 123
FatI CATG 1 cut(s) 121
Fnu4HI GCNGC 2 cut(s) 5, 54
Fsp4HI GCNGC 2 cut(s) 5, 54
GluI GCNGC 2 cut(s) 5, 54
Hin1II CATG 1 cut(s) 125
Hpy188III TCNNGA 1 cut(s) 122
HpyCH4V TGCA 3 cut(s) 4, 67, 140
HpyF3I CTNAG 1 cut(s) 49
Hsp92II CATG 1 cut(s) 125
Kzo9I GATC 1 cut(s) 172
LpnPI CCDG 2 cut(s) 80, 107
Lsp1109I GCAGC 2 cut(s) 16, 40
LweI GCATC 1 cut(s) 76
MalI GATC 1 cut(s) 174
MboI GATC 1 cut(s) 172
MboII GAAGA 3 cut(s) 56, 92, 108
MfeI CAATTG 1 cut(s) 62
MluCI AATT 2 cut(s) 62, 133
MslI CAYNNNNRTG 2 cut(s) 39, 72
MspR9I CCNGG 1 cut(s) 95
MunI CAATTG 1 cut(s) 62
MvaI CCWGG 1 cut(s) 95
NdeII GATC 1 cut(s) 172
NlaIII CATG 1 cut(s) 125
PagI TCATGA 1 cut(s) 121
PkrI GCNGC 2 cut(s) 6, 55
Psp6I CCWGG 1 cut(s) 93
PspGI CCWGG 1 cut(s) 93
RseI CAYNNNNRTG 2 cut(s) 39, 72
SatI GCNGC 2 cut(s) 5, 54
Sau3AI GATC 1 cut(s) 172
ScrFI CCNGG 1 cut(s) 95
SetI ASST 2 cut(s) 55, 76
SfaNI GCATC 1 cut(s) 76
SgeI CNNG 4 cut(s) 83, 106, 107, 134
SmiMI CAYNNNNRTG 2 cut(s) 39, 72
Sse9I AATT 2 cut(s) 62, 133
StyD4I CCNGG 1 cut(s) 93
TasI AATT 2 cut(s) 62, 133
TseI GCWGC 2 cut(s) 4, 53
TspDTI ATGAA 2 cut(s) 102, 102
XapI RAATTY 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.