Rh4CG014800

Homocysteine s-methyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0016411
Physical Location & Seq
Reverse (-)
2546264 .. 2547410
1147 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG014800.1

Sequence Viewer

Length: 288 bp
ATGAGCGATTTTCTGGAGAAGTACGGTGGCTGTGCCGTTCTGGACGGCGGGTTTGCGACGGAGCTGGAACGACATGGAGCTGATCTCAACGACCCTCTCTGGAGCGCCAAATGCCTCGTCAGTTCTCTTCACCTCGTCCGAAGGGTGCATTTAGACTACCTTGATGCTGGAGCAAACATCATAATAACCGCATCTTATGAGGCCACAATTCAGGGTTTTGAGGCCAAAGGTTTCTCTAAAGAAGAAGTCAAAGCCCTGCTCAAGAAAAGTGTAGAAATTGCAATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko00270 ko01100 ko01110 map00270 map01100 map01110
Pfam Domains
Protein Families
S-methyl_trans

Protein Analysis

95

Amino Acids

10.36

Weight (kDa)

5.25

Isoelectric Point (pI)

35.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
S-methyl_trans PF02574 13 - 94 3.2e-22 Homocysteine S-methyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 48, 189
AfaI GTAC 1 cut(s) 23
AluBI AGCT 2 cut(s) 64, 80
AluI AGCT 2 cut(s) 64, 80
AoxI GGCC 2 cut(s) 201, 222
ArsI GACNNNNNNTTYG 4 cut(s) 35, 67, 102, 134
AspLEI GCGC 1 cut(s) 107
AsuHPI GGTGA 1 cut(s) 122
BceAI ACGGC 2 cut(s) 20, 61
BfaI CTAG 1 cut(s) 286
BfoI RGCGCY 1 cut(s) 108
BmsI GCATC 2 cut(s) 154, 200
BplI GAGNNNNNCTC 2 cut(s) 69, 101
BpmI CTGGAG 3 cut(s) 35, 121, 189
BpuEI CTTGAG 1 cut(s) 245
BshFI GGCC 2 cut(s) 203, 224
BsnI GGCC 2 cut(s) 203, 224
Bsp143I GATC 1 cut(s) 82
BspACI CCGC 2 cut(s) 48, 189
BspANI GGCC 2 cut(s) 203, 224
BssMI GATC 1 cut(s) 82
Bst4CI ACNGT 1 cut(s) 26
Bst6I CTCTTC 1 cut(s) 132
BstH2I RGCGCY 1 cut(s) 108
BstHHI GCGC 1 cut(s) 107
BstKTI GATC 1 cut(s) 85
BstMBI GATC 1 cut(s) 82
BstMWI GCNNNNNNNGC 1 cut(s) 111
BsuRI GGCC 2 cut(s) 203, 224
CfoI GCGC 1 cut(s) 107
Csp6I GTAC 1 cut(s) 22
CviAII CATG 1 cut(s) 74
CviJI RGCY 6 cut(s) 30, 64, 80, 203, 224, 254
CviKI_1 RGCY 6 cut(s) 30, 64, 80, 203, 224, 254
CviQI GTAC 1 cut(s) 22
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
Eam1104I CTCTTC 1 cut(s) 132
EarI CTCTTC 1 cut(s) 132
FaeI CATG 1 cut(s) 77
FaiI YATR 3 cut(s) 75, 182, 198
FatI CATG 1 cut(s) 73
FauI CCCGC 1 cut(s) 41
FspBI CTAG 1 cut(s) 286
GlaI GCGC 1 cut(s) 106
GsuI CTGGAG 3 cut(s) 35, 121, 189
HaeII RGCGCY 1 cut(s) 108
HaeIII GGCC 2 cut(s) 203, 224
HhaI GCGC 1 cut(s) 107
Hin1II CATG 1 cut(s) 77
Hin6I GCGC 1 cut(s) 105
HinP1I GCGC 1 cut(s) 105
HphI GGTGA 1 cut(s) 122
Hpy188I TCNGA 1 cut(s) 140
Hpy188III TCNNGA 4 cut(s) 14, 41, 100, 262
Hpy99I CGWCG 1 cut(s) 61
HpyAV CCTTC 1 cut(s) 135
HpyCH4III ACNGT 1 cut(s) 26
HpyCH4V TGCA 2 cut(s) 148, 281
HpyF10VI GCNNNNNNNGC 1 cut(s) 111
Hsp92II CATG 1 cut(s) 77
HspAI GCGC 1 cut(s) 105
Kzo9I GATC 1 cut(s) 82
LmnI GCTCC 4 cut(s) 61, 77, 102, 170
LpnPI CCDG 6 cut(s) 26, 50, 85, 153, 197, 269
LweI GCATC 2 cut(s) 154, 200
MaeI CTAG 1 cut(s) 286
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MboII GAAGA 2 cut(s) 119, 254
MluCI AATT 2 cut(s) 207, 276
MnlI CCTC 5 cut(s) 105, 125, 143, 193, 214
MwoI GCNNNNNNNGC 1 cut(s) 111
NdeII GATC 1 cut(s) 82
NlaIII CATG 1 cut(s) 77
RsaI GTAC 1 cut(s) 23
RsaNI GTAC 1 cut(s) 22
Sau3AI GATC 1 cut(s) 82
SetI ASST 5 cut(s) 66, 82, 135, 162, 232
SfaNI GCATC 2 cut(s) 154, 200
SmlI CTYRAG 1 cut(s) 260
SmoI CTYRAG 1 cut(s) 260
Sse9I AATT 2 cut(s) 207, 276
SsiI CCGC 2 cut(s) 48, 189
SspMI CTAG 1 cut(s) 286
TaaI ACNGT 1 cut(s) 26
TasI AATT 2 cut(s) 207, 276
TspGWI ACGGA 1 cut(s) 74
XspI CTAG 1 cut(s) 286
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.