Rh4CG218200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0013698
Physical Location & Seq
Forward (+)
45052048 .. 45052200
153 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG218200.1

Sequence Viewer

Length: 153 bp
ATGATGGAGGCCATCGGAGGCATCTCTTTTCCGATCGTGTTCTGCGACGGCGAGAGAGAGTCGGAAATCGGAGACGTCGTGATTTACCCGGCAATGGAGTTCAAGCGGTTCCAGGCGGTTCTGAGCCAGAAGATCGAAATCTCACCGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.59

Weight (kDa)

4.38

Isoelectric Point (pI)

59.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7138 PF23596 8 - 50 5.2e-19 Domain of unknown function (DUF7138)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013698)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g20260
malus_domestica MD12G1039700.v1.1 MD14G1038300.v1.1
prunus_persica Prupe.7G095200_v2.0.a1
pyrus_communis pycom03g00540 pycom12g03370 pycom14g03320
rosa_chinensis RchiOBHm_Chr3g0475851
rosa_laevigata RLG00000023807
rosa_multiflora Rmu_co8277165.1_g000001
rosa_roxburghii Rroxscaffold_6G00405790
rosa_rugosa Rorug03G0151700
rosa_samantha Rh3BG232000 Rh3CG226600 Rh3DG227200 Rh4CG218200 Rh7BG133300
rosa_wichuraiana Rw3G018360

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 78
AciI CCGC 2 cut(s) 106, 116
AcyI GRCGYC 1 cut(s) 75
AfiI CCNNNNNNNGG 1 cut(s) 94
AgsI TTSAA 1 cut(s) 103
AjnI CCWGG 1 cut(s) 111
Alw26I GTCTC 1 cut(s) 66
AoxI GGCC 1 cut(s) 9
AsuC2I CCSGG 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 135
BccI CCATC 1 cut(s) 20
BceAI ACGGC 1 cut(s) 64
BciT130I CCWGG 1 cut(s) 113
BcnI CCSGG 1 cut(s) 89
BcoDI GTCTC 1 cut(s) 66
BfaI CTAG 1 cut(s) 151
Bme1390I CCNGG 2 cut(s) 89, 113
BmiI GGNNCC 1 cut(s) 110
BmrFI CCNGG 2 cut(s) 89, 113
BmsI GCATC 1 cut(s) 30
BpuMI CCSGG 1 cut(s) 89
BsaBI GATNNNNATC 1 cut(s) 137
BsaHI GRCGYC 1 cut(s) 75
BsaXI ACNNNNNCTCC 2 cut(s) 63, 93
Bsc4I CCNNNNNNNGG 1 cut(s) 94
Bse3DI GCAATG 1 cut(s) 99
Bse8I GATNNNNATC 1 cut(s) 137
BseBI CCWGG 1 cut(s) 113
BseJI GATNNNNATC 1 cut(s) 137
BseLI CCNNNNNNNGG 1 cut(s) 94
BseMI GCAATG 1 cut(s) 99
BseMII CTCAG 1 cut(s) 113
Bsh1285I CGRYCG 1 cut(s) 36
BshFI GGCC 1 cut(s) 11
BsiEI CGRYCG 1 cut(s) 36
BsiSI CCGG 1 cut(s) 89
BslI CCNNNNNNNGG 1 cut(s) 94
BsmAI GTCTC 1 cut(s) 66
BsmBI CGTCTC 1 cut(s) 66
BsnI GGCC 1 cut(s) 11
Bsp143I GATC 2 cut(s) 33, 132
BspACI CCGC 2 cut(s) 106, 116
BspANI GGCC 1 cut(s) 11
BspCNI CTCAG 1 cut(s) 114
BspLI GGNNCC 1 cut(s) 110
BsrDI GCAATG 1 cut(s) 99
BssMI GATC 2 cut(s) 33, 132
BssNI GRCGYC 1 cut(s) 75
Bst2UI CCWGG 1 cut(s) 113
BstACI GRCGYC 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 122
BstKTI GATC 2 cut(s) 36, 135
BstMAI GTCTC 1 cut(s) 66
BstMBI GATC 2 cut(s) 33, 132
BstMCI CGRYCG 1 cut(s) 36
BstNI CCWGG 1 cut(s) 113
BstSCI CCNGG 2 cut(s) 87, 111
BsuRI GGCC 1 cut(s) 11
CviJI RGCY 2 cut(s) 11, 126
CviKI_1 RGCY 2 cut(s) 11, 126
DdeI CTNAG 1 cut(s) 122
DpnI GATC 2 cut(s) 35, 134
DpnII GATC 2 cut(s) 33, 132
EcoRII CCWGG 1 cut(s) 111
Esp3I CGTCTC 1 cut(s) 66
FspBI CTAG 1 cut(s) 151
HaeIII GGCC 1 cut(s) 11
HapII CCGG 1 cut(s) 89
Hin1I GRCGYC 1 cut(s) 75
HinfI GANTC 1 cut(s) 59
HpaII CCGG 1 cut(s) 89
HphI GGTGA 1 cut(s) 135
Hpy188I TCNGA 5 cut(s) 17, 33, 64, 71, 123
Hpy188III TCNNGA 1 cut(s) 79
Hpy99I CGWCG 2 cut(s) 50, 80
HpyCH4IV ACGT 1 cut(s) 75
HpyF3I CTNAG 1 cut(s) 122
HpySE526I ACGT 1 cut(s) 75
Hsp92I GRCGYC 1 cut(s) 75
Kzo9I GATC 2 cut(s) 33, 132
LpnPI CCDG 4 cut(s) 98, 102, 125, 140
LweI GCATC 1 cut(s) 30
MaeI CTAG 1 cut(s) 151
MaeII ACGT 1 cut(s) 75
MalI GATC 2 cut(s) 35, 134
MboI GATC 2 cut(s) 33, 132
MboII GAAGA 1 cut(s) 142
MlyI GAGTC 1 cut(s) 68
MmeI TCCRAC 1 cut(s) 42
MnlI CCTC 1 cut(s) 11
MspI CCGG 1 cut(s) 89
MspR9I CCNGG 2 cut(s) 89, 113
MvaI CCWGG 1 cut(s) 113
NciI CCSGG 1 cut(s) 89
NdeII GATC 2 cut(s) 33, 132
NlaIV GGNNCC 1 cut(s) 110
PcsI WCGNNNNNNNCGW 2 cut(s) 42, 75
Ple19I CGATCG 1 cut(s) 36
PleI GAGTC 1 cut(s) 67
PpsI GAGTC 1 cut(s) 67
Psp6I CCWGG 1 cut(s) 111
PspGI CCWGG 1 cut(s) 111
PspN4I GGNNCC 1 cut(s) 110
PvuI CGATCG 1 cut(s) 36
Sau3AI GATC 2 cut(s) 33, 132
SchI GAGTC 1 cut(s) 68
ScrFI CCNGG 2 cut(s) 89, 113
SetI ASST 1 cut(s) 78
SfaNI GCATC 1 cut(s) 30
SgeI CNNG 9 cut(s) 49, 64, 91, 100, 101, 115, 124, 125, 139
SsiI CCGC 2 cut(s) 106, 116
SspMI CTAG 1 cut(s) 151
StyD4I CCNGG 2 cut(s) 87, 111
TaiI ACGT 1 cut(s) 78
TaqI TCGA 1 cut(s) 135
XspI CTAG 1 cut(s) 151
ZraI GACGTC 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.