Rh5AG297800

Bacterial trigger factor protein (TF)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0005749
Physical Location & Seq
Reverse (-)
41570971 .. 41574802
3832 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG297800.1

Sequence Viewer

Length: 276 bp
ATGGCCACACTGATGACGACAGTTTCTTCACAGTTCCCCTCCCTTCAATTACCCAAGATACCTAGAGATGTTTTGGTCGAAGTCCTTGGACCATCGAAAGTATATAAGCAAGTAATCAAGAAAGTGATCAACTCTACAGTGGCTGAATATGTAGAGAAGGAATGTTTAAAAGTCAGCAAGGACTTGAGAGTGGAGCAAAGCTTTGAAGATCTTGAAGCCTCTTTTGAACCTGGTGAAGAATTCAGCTTTGATGCTGTAGTTCATCTTCTAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0044424 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Trigger_N

Protein Analysis

91

Amino Acids

10.26

Weight (kDa)

5.11

Isoelectric Point (pI)

44.0

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Trigger_N PF05697 19 - 89 3e-06 Bacterial trigger factor protein (TF)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 239
AgsI TTSAA 4 cut(s) 47, 206, 215, 227
AjnI CCWGG 1 cut(s) 229
AluBI AGCT 2 cut(s) 201, 246
AluI AGCT 2 cut(s) 201, 246
AlwNI CAGNNNCTG 1 cut(s) 143
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 239
AspS9I GGNCC 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 245
AvaII GGWCC 1 cut(s) 89
BalI TGGCCA 1 cut(s) 5
BarI GAAGNNNNNNTAC 1 cut(s) 249
BccI CCATC 1 cut(s) 100
BciT130I CCWGG 1 cut(s) 231
BclI TGATCA 1 cut(s) 126
BfaI CTAG 1 cut(s) 63
BfmI CTRYAG 2 cut(s) 135, 255
BglII AGATCT 1 cut(s) 208
Bme1390I CCNGG 1 cut(s) 231
Bme18I GGWCC 1 cut(s) 89
BmgT120I GGNCC 1 cut(s) 89
BmrFI CCNGG 1 cut(s) 231
BmsI GCATC 1 cut(s) 241
BpuEI CTTGAG 1 cut(s) 205
BsaJI CCNNGG 1 cut(s) 85
BseBI CCWGG 1 cut(s) 231
BseDI CCNNGG 1 cut(s) 85
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 2 cut(s) 126, 208
BspANI GGCC 1 cut(s) 5
BssECI CCNNGG 1 cut(s) 85
BssMI GATC 2 cut(s) 126, 208
BssT1I CCWWGG 1 cut(s) 85
Bst2UI CCWGG 1 cut(s) 231
Bst4CI ACNGT 3 cut(s) 22, 33, 139
BstKTI GATC 2 cut(s) 129, 211
BstMBI GATC 2 cut(s) 126, 208
BstNI CCWGG 1 cut(s) 231
BstSCI CCNGG 1 cut(s) 229
BstSFI CTRYAG 2 cut(s) 135, 255
BstX2I RGATCY 1 cut(s) 208
BstYI RGATCY 1 cut(s) 208
BsuRI GGCC 1 cut(s) 5
BtsIMutI CAGTG 2 cut(s) 8, 144
CaiI CAGNNNCTG 1 cut(s) 143
Cfr13I GGNCC 1 cut(s) 89
CsiI ACCWGGT 1 cut(s) 229
CviJI RGCY 5 cut(s) 5, 143, 201, 218, 246
CviKI_1 RGCY 5 cut(s) 5, 143, 201, 218, 246
DpnI GATC 2 cut(s) 128, 210
DpnII GATC 2 cut(s) 126, 208
DraI TTTAAA 1 cut(s) 168
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 1 cut(s) 85
Eco47I GGWCC 1 cut(s) 89
EcoRI GAATTC 1 cut(s) 239
EcoRII CCWGG 1 cut(s) 229
EcoT14I CCWWGG 1 cut(s) 85
ErhI CCWWGG 1 cut(s) 85
FaiI YATR 3 cut(s) 103, 105, 150
FbaI TGATCA 1 cut(s) 126
FspBI CTAG 1 cut(s) 63
HaeIII GGCC 1 cut(s) 5
HindIII AAGCTT 1 cut(s) 199
HphI GGTGA 1 cut(s) 245
Hpy188III TCNNGA 2 cut(s) 118, 212
HpyAV CCTTC 2 cut(s) 53, 151
HpyCH4III ACNGT 3 cut(s) 22, 33, 139
Ksp22I TGATCA 1 cut(s) 126
Kzo9I GATC 2 cut(s) 126, 208
LmnI GCTCC 1 cut(s) 193
LpnPI CCDG 2 cut(s) 216, 243
LweI GCATC 1 cut(s) 241
MabI ACCWGGT 1 cut(s) 229
MaeI CTAG 1 cut(s) 63
MalI GATC 2 cut(s) 128, 210
MboI GATC 2 cut(s) 126, 208
MboII GAAGA 4 cut(s) 18, 218, 248, 257
MflI RGATCY 1 cut(s) 208
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 47, 239
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 2 cut(s) 49, 229
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 167
MslI CAYNNNNRTG 1 cut(s) 11
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 231
MvaI CCWGG 1 cut(s) 231
NdeII GATC 2 cut(s) 126, 208
Psp6I CCWGG 1 cut(s) 229
PspGI CCWGG 1 cut(s) 229
PspPI GGNCC 1 cut(s) 89
PstNI CAGNNNCTG 1 cut(s) 143
PsuI RGATCY 1 cut(s) 208
RseI CAYNNNNRTG 1 cut(s) 11
SaqAI TTAA 1 cut(s) 167
Sau3AI GATC 2 cut(s) 126, 208
Sau96I GGNCC 1 cut(s) 89
ScrFI CCNGG 1 cut(s) 231
SetI ASST 4 cut(s) 64, 203, 232, 248
SexAI ACCWGGT 1 cut(s) 229
SfaNI GCATC 1 cut(s) 241
SfcI CTRYAG 2 cut(s) 135, 255
SinI GGWCC 1 cut(s) 89
SmiMI CAYNNNNRTG 1 cut(s) 11
SmlI CTYRAG 1 cut(s) 184
SmoI CTYRAG 1 cut(s) 184
Sse9I AATT 2 cut(s) 47, 239
SspMI CTAG 1 cut(s) 63
StyD4I CCNGG 1 cut(s) 229
StyI CCWWGG 1 cut(s) 85
TaaI ACNGT 3 cut(s) 22, 33, 139
TaqI TCGA 2 cut(s) 78, 95
TasI AATT 2 cut(s) 47, 239
Tru1I TTAA 1 cut(s) 167
Tru9I TTAA 1 cut(s) 167
TscAI CASTG 2 cut(s) 15, 144
TspDTI ATGAA 1 cut(s) 251
TspRI CASTG 2 cut(s) 15, 144
VpaK11BI GGWCC 1 cut(s) 89
XapI RAATTY 1 cut(s) 239
XspI CTAG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.