Rh5AG447500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
76930087 .. 76931459
1373 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG447500.1

Sequence Viewer

Length: 189 bp
ATGGGCAATCCAAACATTGAAACGAGGAGAAGCTATACTAGTCATGGATCCAAGGCTACGGAGAAGTGCGGCATCAACCATGGCAATGGAGAAAATCCTCAAGCTAGCTCACGATATTTACAGCAGCATACGCATACAAATACCTTATTTAATAAACAAATTTGGGCAAACATTGTCGCTTTTAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.97

Weight (kDa)

9.51

Isoelectric Point (pI)

51.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 69
AclWI GGATC 2 cut(s) 42, 55
AcsI RAATTY 1 cut(s) 159
AgsI TTSAA 1 cut(s) 20
AhlI ACTAGT 1 cut(s) 38
AluBI AGCT 3 cut(s) 33, 104, 108
AluI AGCT 3 cut(s) 33, 104, 108
AlwI GGATC 2 cut(s) 42, 55
ApeKI GCWGC 1 cut(s) 124
ApoI RAATTY 1 cut(s) 159
AsuNHI GCTAGC 1 cut(s) 104
BamHI GGATCC 1 cut(s) 47
BbvI GCAGC 1 cut(s) 136
BcuI ACTAGT 1 cut(s) 38
BfaI CTAG 2 cut(s) 39, 105
BisI GCNGC 2 cut(s) 70, 125
BlsI GCNGC 2 cut(s) 71, 126
BmiI GGNNCC 1 cut(s) 49
BmsI GCATC 1 cut(s) 81
BmtI GCTAGC 1 cut(s) 108
BpuEI CTTGAG 1 cut(s) 84
BsaJI CCNNGG 2 cut(s) 51, 79
Bse3DI GCAATG 1 cut(s) 91
BseDI CCNNGG 2 cut(s) 51, 79
BseMI GCAATG 1 cut(s) 91
BseRI GAGGAG 1 cut(s) 40
BseXI GCAGC 1 cut(s) 136
Bsp143I GATC 1 cut(s) 47
Bsp19I CCATGG 1 cut(s) 79
BspACI CCGC 1 cut(s) 69
BspLI GGNNCC 1 cut(s) 49
BspOI GCTAGC 1 cut(s) 108
BspPI GGATC 2 cut(s) 42, 55
BsrDI GCAATG 1 cut(s) 91
BssECI CCNNGG 2 cut(s) 51, 79
BssMI GATC 1 cut(s) 47
BssT1I CCWWGG 2 cut(s) 51, 79
BstC8I GCNNGC 1 cut(s) 106
BstDSI CCRYGG 1 cut(s) 79
BstKTI GATC 1 cut(s) 50
BstMBI GATC 1 cut(s) 47
BstMWI GCNNNNNNNGC 1 cut(s) 130
BstV1I GCAGC 1 cut(s) 136
BstX2I RGATCY 1 cut(s) 47
BstXI CCANNNNNNTGG 1 cut(s) 86
BstYI RGATCY 1 cut(s) 47
BtgI CCRYGG 1 cut(s) 79
Cac8I GCNNGC 1 cut(s) 106
CviAII CATG 2 cut(s) 44, 80
CviJI RGCY 4 cut(s) 33, 56, 104, 108
CviKI_1 RGCY 4 cut(s) 33, 56, 104, 108
DpnI GATC 1 cut(s) 49
DpnII GATC 1 cut(s) 47
Eco130I CCWWGG 2 cut(s) 51, 79
EcoT14I CCWWGG 2 cut(s) 51, 79
ErhI CCWWGG 2 cut(s) 51, 79
FaeI CATG 2 cut(s) 47, 83
FaiI YATR 5 cut(s) 36, 45, 81, 129, 135
FatI CATG 2 cut(s) 43, 79
Fnu4HI GCNGC 2 cut(s) 70, 125
Fsp4HI GCNGC 2 cut(s) 70, 125
FspBI CTAG 2 cut(s) 39, 105
GluI GCNGC 2 cut(s) 70, 125
Hin1II CATG 2 cut(s) 47, 83
Hpy188III TCNNGA 1 cut(s) 111
HpyF10VI GCNNNNNNNGC 1 cut(s) 130
Hsp92II CATG 2 cut(s) 47, 83
Kzo9I GATC 1 cut(s) 47
Lsp1109I GCAGC 1 cut(s) 136
LweI GCATC 1 cut(s) 81
MaeI CTAG 2 cut(s) 39, 105
MalI GATC 1 cut(s) 49
MboI GATC 1 cut(s) 47
MflI RGATCY 1 cut(s) 47
MluCI AATT 2 cut(s) 159, 184
MnlI CCTC 2 cut(s) 18, 108
MseI TTAA 3 cut(s) 150, 183, 187
MslI CAYNNNNRTG 1 cut(s) 84
MwoI GCNNNNNNNGC 1 cut(s) 130
NcoI CCATGG 1 cut(s) 79
NdeII GATC 1 cut(s) 47
NheI GCTAGC 1 cut(s) 104
NlaIII CATG 2 cut(s) 47, 83
NlaIV GGNNCC 1 cut(s) 49
PacI TTAATTAA 1 cut(s) 187
PkrI GCNGC 2 cut(s) 71, 126
PspN4I GGNNCC 1 cut(s) 49
PsuI RGATCY 1 cut(s) 47
RseI CAYNNNNRTG 1 cut(s) 84
SaqAI TTAA 3 cut(s) 150, 183, 187
SatI GCNGC 2 cut(s) 70, 125
Sau3AI GATC 1 cut(s) 47
SetI ASST 4 cut(s) 35, 106, 110, 146
SfaNI GCATC 1 cut(s) 81
SgeI CNNG 8 cut(s) 36, 51, 56, 64, 92, 113, 117, 123
SmiMI CAYNNNNRTG 1 cut(s) 84
SmlI CTYRAG 1 cut(s) 99
SmoI CTYRAG 1 cut(s) 99
SpeI ACTAGT 1 cut(s) 38
Sse9I AATT 2 cut(s) 159, 184
SsiI CCGC 1 cut(s) 69
SspMI CTAG 2 cut(s) 39, 105
StyI CCWWGG 2 cut(s) 51, 79
TasI AATT 2 cut(s) 159, 184
TauI GCSGC 1 cut(s) 72
Tru1I TTAA 3 cut(s) 150, 183, 187
Tru9I TTAA 3 cut(s) 150, 183, 187
TseI GCWGC 1 cut(s) 124
TspGWI ACGGA 1 cut(s) 74
XapI RAATTY 1 cut(s) 159
XspI CTAG 2 cut(s) 39, 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.