Rh5CG491700

Heme-binding-like protein At3g10130

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
68451240 .. 68457121
5882 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG491700.1

Sequence Viewer

Length: 168 bp
ATGCCGGGAAAGACTGGTTTTGATTTCAATGGTGCTTCACAATCGTTCAATGTCTTAGCTGAATATAGTAAGATGACTGATAGTACGAAGAAGTACAAAGTATCTAGGTTCAACAAGGATGGTGGGACAATTTGGCTAGATGGTCTAGACCCTGATAAGATTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.08

Weight (kDa)

8.01

Isoelectric Point (pI)

36.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 85, 95
AgsI TTSAA 3 cut(s) 28, 49, 112
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
AsuC2I CCSGG 1 cut(s) 6
BccI CCATC 2 cut(s) 113, 134
BcnI CCSGG 1 cut(s) 6
BfaI CTAG 3 cut(s) 105, 137, 146
Bme1390I CCNGG 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 6
BpuMI CCSGG 1 cut(s) 6
Bse1I ACTGG 1 cut(s) 19
BseGI GGATG 1 cut(s) 124
BseNI ACTGG 1 cut(s) 19
BsiSI CCGG 1 cut(s) 5
BslFI GGGAC 1 cut(s) 139
BsmFI GGGAC 1 cut(s) 139
BsrI ACTGG 1 cut(s) 19
BstDEI CTNAG 1 cut(s) 55
BstF5I GGATG 1 cut(s) 124
BstSCI CCNGG 1 cut(s) 4
BtsCI GGATG 1 cut(s) 124
Csp6I GTAC 2 cut(s) 84, 94
CspCI CAANNNNNGTGG 2 cut(s) 103, 138
CviJI RGCY 2 cut(s) 59, 136
CviKI_1 RGCY 2 cut(s) 59, 136
CviQI GTAC 2 cut(s) 84, 94
DdeI CTNAG 1 cut(s) 55
FaiI YATR 2 cut(s) 66, 166
FaqI GGGAC 1 cut(s) 139
FokI GGATG 1 cut(s) 131
FspBI CTAG 3 cut(s) 105, 137, 146
HapII CCGG 1 cut(s) 5
HpaII CCGG 1 cut(s) 5
Hpy188III TCNNGA 1 cut(s) 146
HpyCH4V TGCA 1 cut(s) 164
HpyF3I CTNAG 1 cut(s) 55
LpnPI CCDG 1 cut(s) 18
MaeI CTAG 3 cut(s) 105, 137, 146
MboII GAAGA 1 cut(s) 100
MluCI AATT 1 cut(s) 129
MspI CCGG 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 6
NciI CCSGG 1 cut(s) 6
RsaI GTAC 2 cut(s) 85, 95
RsaNI GTAC 2 cut(s) 84, 94
ScrFI CCNGG 1 cut(s) 6
SetI ASST 2 cut(s) 61, 110
SgeI CNNG 8 cut(s) 17, 18, 27, 117, 127, 149, 158, 164
Sse9I AATT 1 cut(s) 129
SspMI CTAG 3 cut(s) 105, 137, 146
StyD4I CCNGG 1 cut(s) 4
TasI AATT 1 cut(s) 129
TatI WGTACW 1 cut(s) 93
XbaI TCTAGA 1 cut(s) 145
XspI CTAG 3 cut(s) 105, 137, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.