Rh5DG431400

PRP38 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
68987474 .. 68990783
3310 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG431400.1

Sequence Viewer

Length: 291 bp
ATGGAGACTCTGGTGGACAAGGCCATGGAGCTTGACCACATCGGCGAGACCTTTGGAGGTAATCGAAAACCCACACCGTTCATTTATGAAGATGCTTCAGATGCATCGAAGAAGGAAATCGTCATCGAGTTCATTAAGAACGACGACTATGAATGCATAGTAAAAGCTGTTTTGGATGTAAGCATCGAGATACTGGCCACTGTAGGTGAAGATGATGGGGTAACACGCTGGCTTGATTTGGACTGGAACATGAGATTGTCTCTTGCATTGAACAACCACAAGTGCAGATAA

Protein Analysis

96

Amino Acids

10.93

Weight (kDa)

4.51

Isoelectric Point (pI)

41.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 195
AcuI CTGAAG 1 cut(s) 81
AgsI TTSAA 1 cut(s) 271
AluBI AGCT 2 cut(s) 31, 167
AluI AGCT 2 cut(s) 31, 167
Alw26I GTCTC 2 cut(s) 41, 264
AoxI GGCC 2 cut(s) 21, 195
AsuHPI GGTGA 1 cut(s) 218
BalI TGGCCA 1 cut(s) 197
BccI CCATC 1 cut(s) 209
BcoDI GTCTC 2 cut(s) 41, 264
BfmI CTRYAG 1 cut(s) 201
BmsI GCATC 4 cut(s) 82, 91, 113, 192
BplI GAGNNNNNCTC 2 cut(s) 244, 276
BsaI GGTCTC 1 cut(s) 41
BsaJI CCNNGG 1 cut(s) 24
Bse1I ACTGG 2 cut(s) 198, 248
BseDI CCNNGG 1 cut(s) 24
BseGI GGATG 1 cut(s) 181
BseNI ACTGG 2 cut(s) 198, 248
BshFI GGCC 2 cut(s) 23, 197
BsmAI GTCTC 2 cut(s) 41, 264
BsmI GAATGC 1 cut(s) 158
BsnI GGCC 2 cut(s) 23, 197
Bso31I GGTCTC 1 cut(s) 41
Bsp19I CCATGG 1 cut(s) 24
BspANI GGCC 2 cut(s) 23, 197
BspTNI GGTCTC 1 cut(s) 41
BsrI ACTGG 2 cut(s) 198, 248
BssECI CCNNGG 1 cut(s) 24
BssT1I CCWWGG 1 cut(s) 24
Bst4CI ACNGT 2 cut(s) 78, 202
BstC8I GCNNGC 1 cut(s) 230
BstDSI CCRYGG 1 cut(s) 24
BstF5I GGATG 1 cut(s) 181
BstMAI GTCTC 2 cut(s) 41, 264
BstMWI GCNNNNNNNGC 1 cut(s) 101
BstSFI CTRYAG 1 cut(s) 201
BsuRI GGCC 2 cut(s) 23, 197
BtgI CCRYGG 1 cut(s) 24
BtsCI GGATG 1 cut(s) 181
BtsIMutI CAGTG 1 cut(s) 198
Cac8I GCNNGC 1 cut(s) 230
CviAII CATG 2 cut(s) 25, 250
CviJI RGCY 5 cut(s) 23, 31, 167, 197, 232
CviKI_1 RGCY 5 cut(s) 23, 31, 167, 197, 232
EaeI YGGCCR 1 cut(s) 195
Eco130I CCWWGG 1 cut(s) 24
Eco31I GGTCTC 1 cut(s) 41
Eco57I CTGAAG 1 cut(s) 81
EcoT14I CCWWGG 1 cut(s) 24
EcoT22I ATGCAT 2 cut(s) 106, 158
ErhI CCWWGG 1 cut(s) 24
FaeI CATG 2 cut(s) 28, 253
FaiI YATR 5 cut(s) 26, 87, 150, 158, 251
FatI CATG 2 cut(s) 24, 249
FokI GGATG 1 cut(s) 188
HaeIII GGCC 2 cut(s) 23, 197
Hin1II CATG 2 cut(s) 28, 253
HinfI GANTC 1 cut(s) 7
HphI GGTGA 1 cut(s) 218
Hpy166II GTNNAC 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 100
Hpy188III TCNNGA 1 cut(s) 187
Hpy8I GTNNAC 1 cut(s) 16
Hpy99I CGWCG 1 cut(s) 146
HpyAV CCTTC 1 cut(s) 106
HpyCH4III ACNGT 2 cut(s) 78, 202
HpyCH4V TGCA 4 cut(s) 104, 156, 266, 285
HpyF10VI GCNNNNNNNGC 1 cut(s) 101
Hsp92II CATG 2 cut(s) 28, 253
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 3 cut(s) 179, 214, 229
LweI GCATC 4 cut(s) 82, 91, 113, 192
MaeIII GTNAC 1 cut(s) 220
MboII GAAGA 3 cut(s) 101, 121, 221
MlsI TGGCCA 1 cut(s) 197
MluNI TGGCCA 1 cut(s) 197
MnlI CCTC 1 cut(s) 50
Mox20I TGGCCA 1 cut(s) 197
Mph1103I ATGCAT 2 cut(s) 106, 158
MscI TGGCCA 1 cut(s) 197
MseI TTAA 1 cut(s) 135
Msp20I TGGCCA 1 cut(s) 197
Mva1269I GAATGC 1 cut(s) 158
MwoI GCNNNNNNNGC 1 cut(s) 101
NcoI CCATGG 1 cut(s) 24
NlaIII CATG 2 cut(s) 28, 253
NsiI ATGCAT 2 cut(s) 106, 158
PctI GAATGC 1 cut(s) 158
SaqAI TTAA 1 cut(s) 135
SetI ASST 5 cut(s) 33, 53, 61, 169, 208
SfaNI GCATC 4 cut(s) 82, 91, 113, 192
SfcI CTRYAG 1 cut(s) 201
StyI CCWWGG 1 cut(s) 24
TaaI ACNGT 2 cut(s) 78, 202
TaqI TCGA 4 cut(s) 64, 107, 126, 186
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TscAI CASTG 1 cut(s) 205
TspDTI ATGAA 4 cut(s) 70, 102, 121, 165
TspRI CASTG 1 cut(s) 205
Zsp2I ATGCAT 2 cut(s) 106, 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.