Rh6BG022200

transcriptional co-repressor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
3259142 .. 3261218
2077 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG022200.1

Sequence Viewer

Length: 249 bp
ATGTCCACTATTCTGGCGTGCAAGGTCAATCAGTTGGATCTACAAGCAAATAGTAATTTGGTTCTGACAGCTAGGCGGTGTTTGCAGATATCAGAGGTTGTGAACAGCATGAAAGATTTGATCGAATTCTGCCAGGAAAACAAAGTTGGCCCAATTGGTTTATCCATGACATGCGAATGCAACCAAGCTTCAGATGCAAAGGATGTAGGAAATGGAGCAGTTAGCAAGTGTTCAGGGCATGCCAACTGA

Protein Analysis

82

Amino Acids

8.73

Weight (kDa)

5.63

Isoelectric Point (pI)

47.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LIM_bind PF01803 25 - 52 1e-07 LIM-domain binding protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 76
AclWI GGATC 1 cut(s) 45
AcsI RAATTY 1 cut(s) 125
AcuI CTGAAG 1 cut(s) 174
AjnI CCWGG 1 cut(s) 132
AjuI GAANNNNNNNTTGG 2 cut(s) 129, 161
AluBI AGCT 2 cut(s) 71, 188
AluI AGCT 2 cut(s) 71, 188
AlwI GGATC 1 cut(s) 45
AoxI GGCC 1 cut(s) 148
ApoI RAATTY 1 cut(s) 125
AspS9I GGNCC 1 cut(s) 149
BciT130I CCWGG 1 cut(s) 134
BfaI CTAG 1 cut(s) 72
Bme1390I CCNGG 1 cut(s) 134
BmgT120I GGNCC 1 cut(s) 149
BmrFI CCNGG 1 cut(s) 134
BmsI GCATC 1 cut(s) 184
BseBI CCWGG 1 cut(s) 134
BseGI GGATG 1 cut(s) 208
BshFI GGCC 1 cut(s) 150
BsmI GAATGC 1 cut(s) 182
BsnI GGCC 1 cut(s) 150
Bsp143I GATC 2 cut(s) 37, 120
BspACI CCGC 1 cut(s) 76
BspANI GGCC 1 cut(s) 150
BspPI GGATC 1 cut(s) 45
BssMI GATC 2 cut(s) 37, 120
Bst2UI CCWGG 1 cut(s) 134
BstC8I GCNNGC 2 cut(s) 19, 240
BstF5I GGATG 1 cut(s) 208
BstKTI GATC 2 cut(s) 40, 123
BstMBI GATC 2 cut(s) 37, 120
BstMWI GCNNNNNNNGC 2 cut(s) 82, 194
BstNI CCWGG 1 cut(s) 134
BstNSI RCATGY 2 cut(s) 174, 242
BstSCI CCNGG 1 cut(s) 132
BstX2I RGATCY 1 cut(s) 37
BstXI CCANNNNNNTGG 1 cut(s) 13
BstYI RGATCY 1 cut(s) 37
BsuRI GGCC 1 cut(s) 150
BtsCI GGATG 1 cut(s) 208
Cac8I GCNNGC 2 cut(s) 19, 240
Cfr13I GGNCC 1 cut(s) 149
CviAII CATG 4 cut(s) 109, 166, 171, 239
CviJI RGCY 3 cut(s) 71, 150, 188
CviKI_1 RGCY 3 cut(s) 71, 150, 188
DpnI GATC 2 cut(s) 39, 122
DpnII GATC 2 cut(s) 37, 120
Eco32I GATATC 1 cut(s) 90
Eco57I CTGAAG 1 cut(s) 174
EcoRI GAATTC 1 cut(s) 125
EcoRII CCWGG 1 cut(s) 132
EcoRV GATATC 1 cut(s) 90
FaeI CATG 4 cut(s) 112, 169, 174, 242
FaiI YATR 4 cut(s) 110, 167, 172, 240
FatI CATG 4 cut(s) 108, 165, 170, 238
FokI GGATG 1 cut(s) 215
FspBI CTAG 1 cut(s) 72
HaeIII GGCC 1 cut(s) 150
Hin1II CATG 4 cut(s) 112, 169, 174, 242
HindIII AAGCTT 1 cut(s) 186
Hpy166II GTNNAC 2 cut(s) 6, 103
Hpy188I TCNGA 3 cut(s) 66, 94, 193
Hpy8I GTNNAC 2 cut(s) 6, 103
HpyCH4V TGCA 4 cut(s) 21, 85, 180, 197
HpyF10VI GCNNNNNNNGC 2 cut(s) 82, 194
Hsp92II CATG 4 cut(s) 112, 169, 174, 242
Kzo9I GATC 2 cut(s) 37, 120
LmnI GCTCC 1 cut(s) 215
LpnPI CCDG 3 cut(s) 119, 146, 219
LweI GCATC 1 cut(s) 184
MaeI CTAG 1 cut(s) 72
MalI GATC 2 cut(s) 39, 122
MboI GATC 2 cut(s) 37, 120
MfeI CAATTG 1 cut(s) 153
MflI RGATCY 1 cut(s) 37
MluCI AATT 3 cut(s) 55, 125, 153
MmeI TCCRAC 1 cut(s) 15
MnlI CCTC 1 cut(s) 88
MslI CAYNNNNRTG 1 cut(s) 175
MspR9I CCNGG 1 cut(s) 134
MunI CAATTG 1 cut(s) 153
Mva1269I GAATGC 1 cut(s) 182
MvaI CCWGG 1 cut(s) 134
MwoI GCNNNNNNNGC 2 cut(s) 82, 194
NdeII GATC 2 cut(s) 37, 120
NlaIII CATG 4 cut(s) 112, 169, 174, 242
NspI RCATGY 2 cut(s) 174, 242
PaeI GCATGC 1 cut(s) 242
PctI GAATGC 1 cut(s) 182
Psp6I CCWGG 1 cut(s) 132
PspGI CCWGG 1 cut(s) 132
PspPI GGNCC 1 cut(s) 149
PsuI RGATCY 1 cut(s) 37
RseI CAYNNNNRTG 1 cut(s) 175
Sau3AI GATC 2 cut(s) 37, 120
Sau96I GGNCC 1 cut(s) 149
ScrFI CCNGG 1 cut(s) 134
SetI ASST 4 cut(s) 27, 73, 99, 190
SfaNI GCATC 1 cut(s) 184
SmiMI CAYNNNNRTG 1 cut(s) 175
SphI GCATGC 1 cut(s) 242
Sse9I AATT 3 cut(s) 55, 125, 153
SsiI CCGC 1 cut(s) 76
SspMI CTAG 1 cut(s) 72
StyD4I CCNGG 1 cut(s) 132
TaqI TCGA 1 cut(s) 123
TasI AATT 3 cut(s) 55, 125, 153
TspDTI ATGAA 1 cut(s) 125
XapI RAATTY 1 cut(s) 125
XceI RCATGY 2 cut(s) 174, 242
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.