Rh6BG044700

Thymocyte nuclear protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0012175
Physical Location & Seq
Forward (+)
7079421 .. 7085136
5716 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG044700.1

Sequence Viewer

Length: 273 bp
ATGAAACTATATTATCACCTTGTCAAGGAAGGTGAAGGTGGAGATGGTGCGGTTGATGTGAAGGCAGTTGGGGAGATGAGGAGGCCGATTAACTTGAAGGAGATGAAGAGGGAGGAGGGCCTCAAGGGTTTTGCTCTGTTTCGACAGCCGAGGCTGTCGGTTGTGCCAGTTTCGGAGGATGTGTGGTTGAAAGTTTGTGATTTGGGAGGTGGGTTTGAAGGTGATGGTATTGTTGTGGAAGATGATGAATCTGGTGATGAAGGATATGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EVE

Protein Analysis

90

Amino Acids

9.93

Weight (kDa)

4.6

Isoelectric Point (pI)

39.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EVE PF01878 17 - 67 2.4e-10 EVE domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 50
AfiI CCNNNNNNNGG 1 cut(s) 25
AgsI TTSAA 3 cut(s) 97, 190, 218
AoxI GGCC 2 cut(s) 83, 118
AspS9I GGNCC 1 cut(s) 118
AsuHPI GGTGA 4 cut(s) 8, 44, 233, 266
BccI CCATC 2 cut(s) 38, 218
BmgT120I GGNCC 1 cut(s) 118
BpuEI CTTGAG 1 cut(s) 107
BsaJI CCNNGG 1 cut(s) 149
BsaXI ACNNNNNCTCC 2 cut(s) 167, 197
Bsc4I CCNNNNNNNGG 1 cut(s) 25
Bse1I ACTGG 1 cut(s) 167
BseDI CCNNGG 1 cut(s) 149
BseGI GGATG 1 cut(s) 184
BseLI CCNNNNNNNGG 1 cut(s) 25
BseNI ACTGG 1 cut(s) 167
BseRI GAGGAG 2 cut(s) 94, 128
BshFI GGCC 2 cut(s) 85, 120
BslI CCNNNNNNNGG 1 cut(s) 25
BsnI GGCC 2 cut(s) 85, 120
BspACI CCGC 1 cut(s) 50
BspANI GGCC 2 cut(s) 85, 120
BsrI ACTGG 1 cut(s) 167
BssECI CCNNGG 1 cut(s) 149
Bst6I CTCTTC 1 cut(s) 101
BstENI CCTNNNNNAGG 1 cut(s) 23
BstF5I GGATG 1 cut(s) 184
BsuRI GGCC 2 cut(s) 85, 120
BtsCI GGATG 1 cut(s) 184
Cfr13I GGNCC 1 cut(s) 118
CviJI RGCY 4 cut(s) 85, 120, 148, 154
CviKI_1 RGCY 4 cut(s) 85, 120, 148, 154
Eam1104I CTCTTC 1 cut(s) 101
EarI CTCTTC 1 cut(s) 101
EcoNI CCTNNNNNAGG 1 cut(s) 23
EcoO109I RGGNCCY 1 cut(s) 118
FaiI YATR 2 cut(s) 10, 267
FokI GGATG 1 cut(s) 191
HaeIII GGCC 2 cut(s) 85, 120
HinfI GANTC 1 cut(s) 248
HphI GGTGA 4 cut(s) 8, 44, 233, 266
Hpy188I TCNGA 1 cut(s) 175
HpyAV CCTTC 6 cut(s) 23, 29, 55, 91, 212, 254
LpnPI CCDG 2 cut(s) 180, 237
MboII GAAGA 2 cut(s) 118, 251
MnlI CCTC 9 cut(s) 72, 75, 102, 106, 109, 131, 144, 169, 200
MseI TTAA 1 cut(s) 90
NmeAIII GCCGAG 1 cut(s) 174
PfeI GAWTC 1 cut(s) 248
PspPI GGNCC 1 cut(s) 118
SaqAI TTAA 1 cut(s) 90
Sau96I GGNCC 1 cut(s) 118
SetI ASST 5 cut(s) 21, 34, 40, 211, 223
SgeI CNNG 7 cut(s) 32, 37, 106, 136, 162, 179, 264
SmlI CTYRAG 1 cut(s) 122
SmoI CTYRAG 1 cut(s) 122
SsiI CCGC 1 cut(s) 50
TaqI TCGA 1 cut(s) 142
TfiI GAWTC 1 cut(s) 248
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TspDTI ATGAA 4 cut(s) 17, 119, 261, 273
XagI CCTNNNNNAGG 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.