Rh6BG494400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0006923
Physical Location & Seq
Reverse (-)
69618086 .. 69618268
183 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG494400.1

Sequence Viewer

Length: 183 bp
ATGCCCAATTCCCGTTATCATGTTGTCTACGACGCCAACGTCGTCGTCGATGACGGTGAAGAGCCGATATTCCAGATTGTGAAAAGTGGCGGTTTCGAAATCGAGATCAACGATAGCCCTGGTGGGATCGTCGGTGCAGTAGCAGGTTCGCATCACATCCCGACCACCGTCACCCTCATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.36

Weight (kDa)

4.49

Isoelectric Point (pI)

55.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 38
Acc36I ACCTGC 1 cut(s) 134
AccI GTMKAC 1 cut(s) 27
AciI CCGC 1 cut(s) 90
AclWI GGATC 1 cut(s) 134
AcyI GRCGYC 1 cut(s) 33
AjnI CCWGG 1 cut(s) 118
AlwI GGATC 1 cut(s) 134
AsuHPI GGTGA 2 cut(s) 68, 163
AsuII TTCGAA 1 cut(s) 96
BciT130I CCWGG 1 cut(s) 120
BfuAI ACCTGC 1 cut(s) 134
Bme1390I CCNGG 1 cut(s) 120
BmrFI CCNGG 1 cut(s) 120
BmsI GCATC 1 cut(s) 160
BoxI GACNNNNGTC 1 cut(s) 167
Bpu14I TTCGAA 1 cut(s) 96
BsaHI GRCGYC 1 cut(s) 33
BsaJI CCNNGG 1 cut(s) 118
BseBI CCWGG 1 cut(s) 120
BseDI CCNNGG 1 cut(s) 118
BseGI GGATG 1 cut(s) 156
BsgI GTGCAG 1 cut(s) 156
Bsp119I TTCGAA 1 cut(s) 96
Bsp143I GATC 2 cut(s) 105, 126
BspACI CCGC 1 cut(s) 90
BspMI ACCTGC 1 cut(s) 134
BspPI GGATC 1 cut(s) 134
BspQI GCTCTTC 1 cut(s) 54
BspT104I TTCGAA 1 cut(s) 96
BssECI CCNNGG 1 cut(s) 118
BssMI GATC 2 cut(s) 105, 126
BssNI GRCGYC 1 cut(s) 33
Bst2UI CCWGG 1 cut(s) 120
Bst4CI ACNGT 2 cut(s) 56, 169
Bst6I CTCTTC 1 cut(s) 54
BstACI GRCGYC 1 cut(s) 33
BstBI TTCGAA 1 cut(s) 96
BstF5I GGATG 1 cut(s) 156
BstKTI GATC 2 cut(s) 108, 129
BstMBI GATC 2 cut(s) 105, 126
BstNI CCWGG 1 cut(s) 120
BstPAI GACNNNNGTC 1 cut(s) 167
BstSCI CCNGG 1 cut(s) 118
BtsCI GGATG 1 cut(s) 156
BveI ACCTGC 1 cut(s) 134
CseI GACGC 1 cut(s) 41
CviAII CATG 1 cut(s) 20
CviJI RGCY 2 cut(s) 64, 117
CviKI_1 RGCY 2 cut(s) 64, 117
DpnI GATC 2 cut(s) 107, 128
DpnII GATC 2 cut(s) 105, 126
DrdI GACNNNNNNGTC 1 cut(s) 38
DseDI GACNNNNNNGTC 1 cut(s) 38
Eam1104I CTCTTC 1 cut(s) 54
EarI CTCTTC 1 cut(s) 54
EcoRII CCWGG 1 cut(s) 118
FaeI CATG 1 cut(s) 23
FaiI YATR 3 cut(s) 21, 179, 181
FatI CATG 1 cut(s) 19
FblI GTMKAC 1 cut(s) 27
FokI GGATG 1 cut(s) 143
HgaI GACGC 1 cut(s) 41
Hin1I GRCGYC 1 cut(s) 33
Hin1II CATG 1 cut(s) 23
HphI GGTGA 2 cut(s) 68, 163
Hpy166II GTNNAC 1 cut(s) 28
Hpy188III TCNNGA 3 cut(s) 73, 103, 160
Hpy8I GTNNAC 1 cut(s) 28
Hpy99I CGWCG 5 cut(s) 35, 44, 47, 50, 134
HpyCH4III ACNGT 2 cut(s) 56, 169
HpyCH4IV ACGT 1 cut(s) 39
HpyCH4V TGCA 1 cut(s) 137
HpySE526I ACGT 1 cut(s) 39
Hsp92I GRCGYC 1 cut(s) 33
Hsp92II CATG 1 cut(s) 23
Kzo9I GATC 2 cut(s) 105, 126
LguI GCTCTTC 1 cut(s) 54
LpnPI CCDG 4 cut(s) 86, 105, 129, 132
LweI GCATC 1 cut(s) 160
MaeII ACGT 1 cut(s) 39
MaeIII GTNAC 1 cut(s) 169
MalI GATC 2 cut(s) 107, 128
MboI GATC 2 cut(s) 105, 126
MboII GAAGA 1 cut(s) 71
MluCI AATT 1 cut(s) 7
MspR9I CCNGG 1 cut(s) 120
MvaI CCWGG 1 cut(s) 120
NdeII GATC 2 cut(s) 105, 126
NlaIII CATG 1 cut(s) 23
NmuCI GTSAC 1 cut(s) 169
NspV TTCGAA 1 cut(s) 96
PciSI GCTCTTC 1 cut(s) 54
PcsI WCGNNNNNNNCGW 4 cut(s) 36, 39, 45, 108
PshAI GACNNNNGTC 1 cut(s) 167
Psp6I CCWGG 1 cut(s) 118
PspGI CCWGG 1 cut(s) 118
SapI GCTCTTC 1 cut(s) 54
Sau3AI GATC 2 cut(s) 105, 126
ScrFI CCNGG 1 cut(s) 120
SetI ASST 2 cut(s) 42, 148
SfaNI GCATC 1 cut(s) 160
SfuI TTCGAA 1 cut(s) 96
SgeI CNNG 8 cut(s) 24, 32, 85, 115, 131, 132, 156, 172
Sse9I AATT 1 cut(s) 7
SsiI CCGC 1 cut(s) 90
StyD4I CCNGG 1 cut(s) 118
TaaI ACNGT 2 cut(s) 56, 169
TaiI ACGT 1 cut(s) 42
TaqI TCGA 3 cut(s) 48, 96, 102
TasI AATT 1 cut(s) 7
TseFI GTSAC 1 cut(s) 169
Tsp45I GTSAC 1 cut(s) 169
XmiI GTMKAC 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.