Rh6CG484900

carboxylesterase 2

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0011899
Physical Location & Seq
Reverse (-)
65374829 .. 65375116
288 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG484900.1

Sequence Viewer

Length: 288 bp
ATGCTTGTTGCTGAGGCCAGAGCTATTACTGTTTCTATTAATTACAGATTAGCCCCTGAGCATCCATTACCGATTGCCTATGAGGATTCTTGGGCAGTACTTCAATGGGTTTTTGGTGGTGAAGATCGTGACGATTGGGTTAAGGATCATGTTGAATTTGAGCGAGAAGTGTTCTTGGTGGGAGATAGTGCTGGGCCTAATATTGCACACCACTTGGCCTTGCGGGTCAAGAAGTCCGACCCATCCTTATTTCTGGGGGAAAGTTCCGATTGGCCGGGAGGTGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0003674 GO:0003824 GO:0008150 GO:0008152 GO:0009056 GO:0016787
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_3

Protein Analysis

95

Amino Acids

10.59

Weight (kDa)

4.73

Isoelectric Point (pI)

32.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Abhydrolase_3 PF07859 2 - 79 6.6e-24 alpha/beta hydrolase fold
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 223
AclWI GGATC 1 cut(s) 153
AcoI YGGCCR 1 cut(s) 272
AcsI RAATTY 1 cut(s) 155
AfaI GTAC 1 cut(s) 99
AfiI CCNNNNNNNGG 1 cut(s) 281
AgsI TTSAA 2 cut(s) 104, 155
AluBI AGCT 1 cut(s) 23
AluI AGCT 1 cut(s) 23
AlwI GGATC 1 cut(s) 153
AoxI GGCC 4 cut(s) 15, 194, 216, 272
ApoI RAATTY 1 cut(s) 155
AseI ATTAAT 1 cut(s) 39
AspS9I GGNCC 1 cut(s) 194
AsuC2I CCSGG 1 cut(s) 276
AsuHPI GGTGA 1 cut(s) 131
BbvCI CCTCAGC 1 cut(s) 12
BccI CCATC 1 cut(s) 250
BcnI CCSGG 1 cut(s) 276
BmcAI AGTACT 1 cut(s) 99
Bme1390I CCNGG 1 cut(s) 276
BmgT120I GGNCC 1 cut(s) 194
BmrFI CCNGG 1 cut(s) 276
BmsI GCATC 1 cut(s) 70
Bpu10I CCTNAGC 2 cut(s) 12, 57
BpuMI CCSGG 1 cut(s) 276
Bsc4I CCNNNNNNNGG 1 cut(s) 281
BseGI GGATG 2 cut(s) 61, 242
BseLI CCNNNNNNNGG 1 cut(s) 281
BseMII CTCAG 1 cut(s) 48
BseYI CCCAGC 1 cut(s) 191
BshFI GGCC 4 cut(s) 17, 196, 218, 274
BsiSI CCGG 1 cut(s) 275
BslI CCNNNNNNNGG 1 cut(s) 281
BsnI GGCC 4 cut(s) 17, 196, 218, 274
Bsp143I GATC 2 cut(s) 124, 145
BspACI CCGC 1 cut(s) 223
BspANI GGCC 4 cut(s) 17, 196, 218, 274
BspCNI CTCAG 2 cut(s) 4, 49
BspPI GGATC 1 cut(s) 153
BssMI GATC 2 cut(s) 124, 145
Bst4CI ACNGT 1 cut(s) 31
BstDEI CTNAG 2 cut(s) 12, 57
BstF5I GGATG 2 cut(s) 61, 242
BstKTI GATC 2 cut(s) 127, 148
BstMBI GATC 2 cut(s) 124, 145
BstSCI CCNGG 1 cut(s) 274
BsuRI GGCC 4 cut(s) 17, 196, 218, 274
BtsCI GGATG 2 cut(s) 61, 242
Cfr13I GGNCC 1 cut(s) 194
Csp6I GTAC 1 cut(s) 98
CviAII CATG 1 cut(s) 149
CviJI RGCY 6 cut(s) 17, 23, 53, 196, 218, 274
CviKI_1 RGCY 6 cut(s) 17, 23, 53, 196, 218, 274
CviQI GTAC 1 cut(s) 98
DdeI CTNAG 2 cut(s) 12, 57
DpnI GATC 2 cut(s) 126, 147
DpnII GATC 2 cut(s) 124, 145
EaeI YGGCCR 1 cut(s) 272
FaeI CATG 1 cut(s) 152
FaiI YATR 2 cut(s) 81, 150
FatI CATG 1 cut(s) 148
FauI CCCGC 1 cut(s) 216
FokI GGATG 2 cut(s) 48, 229
GsaI CCCAGC 1 cut(s) 195
HaeIII GGCC 4 cut(s) 17, 196, 218, 274
HapII CCGG 1 cut(s) 275
Hin1II CATG 1 cut(s) 152
HinfI GANTC 1 cut(s) 86
HpaII CCGG 1 cut(s) 275
HphI GGTGA 1 cut(s) 131
Hpy188I TCNGA 2 cut(s) 238, 268
Hpy188III TCNNGA 2 cut(s) 128, 229
HpyCH4III ACNGT 1 cut(s) 31
HpyCH4V TGCA 1 cut(s) 206
HpyF3I CTNAG 2 cut(s) 12, 57
Hsp92II CATG 1 cut(s) 152
Kzo9I GATC 2 cut(s) 124, 145
LpnPI CCDG 4 cut(s) 31, 69, 177, 239
LweI GCATC 1 cut(s) 70
MaeIII GTNAC 1 cut(s) 128
MalI GATC 2 cut(s) 126, 147
MboI GATC 2 cut(s) 124, 145
MboII GAAGA 1 cut(s) 134
MluCI AATT 2 cut(s) 40, 155
MmeI TCCRAC 1 cut(s) 261
MnlI CCTC 3 cut(s) 7, 76, 272
MseI TTAA 2 cut(s) 39, 141
MspI CCGG 1 cut(s) 275
MspR9I CCNGG 1 cut(s) 276
NciI CCSGG 1 cut(s) 276
NdeII GATC 2 cut(s) 124, 145
NlaIII CATG 1 cut(s) 152
NmuCI GTSAC 1 cut(s) 128
PfeI GAWTC 1 cut(s) 86
PshBI ATTAAT 1 cut(s) 39
PspFI CCCAGC 1 cut(s) 191
PspPI GGNCC 1 cut(s) 194
RsaI GTAC 1 cut(s) 99
RsaNI GTAC 1 cut(s) 98
SaqAI TTAA 2 cut(s) 39, 141
Sau3AI GATC 2 cut(s) 124, 145
Sau96I GGNCC 1 cut(s) 194
ScaI AGTACT 1 cut(s) 99
ScrFI CCNGG 1 cut(s) 276
SetI ASST 2 cut(s) 25, 283
SfaNI GCATC 1 cut(s) 70
Sse9I AATT 2 cut(s) 40, 155
SsiI CCGC 1 cut(s) 223
SspI AATATT 1 cut(s) 202
StyD4I CCNGG 1 cut(s) 274
TaaI ACNGT 1 cut(s) 31
TasI AATT 2 cut(s) 40, 155
TatI WGTACW 1 cut(s) 97
TfiI GAWTC 1 cut(s) 86
Tru1I TTAA 2 cut(s) 39, 141
Tru9I TTAA 2 cut(s) 39, 141
TseFI GTSAC 1 cut(s) 128
Tsp45I GTSAC 1 cut(s) 128
VspI ATTAAT 1 cut(s) 39
XapI RAATTY 1 cut(s) 155
ZrmI AGTACT 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.