Rh6DG083600

GDP-fucose protein O-fucosyltransferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
9770921 .. 9772022
1102 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG083600.1

Sequence Viewer

Length: 354 bp
ATGTTTAAAAATGTTGTTGATGGGACCTCCCTCAACATTTTCTGGGAGCTTAGTAGGATTTATGGCCATGAGGCTAACCTCTTTGAAAGTAATCCCAGGAGACCACCTACAGTTGAGGAAGAGATGAAGGTTGAAGCATGGAAAACTGTAGGGCCACGTCCTCTTCCACTTCCACTTCCACCGCCTTCAGCCAGGCCCAAATCATATAACATGGAAGGTTGGTGGGGATGGGTCGCTGAGAGTGATAATAAGCGTGATAGTACAGCTATGGAATTGAGGACAAACGCTCATAAACTACTGTGGGGTGCAGTTGATTACAAAAGAAGTCGTCAGGCTCTTGGAAGAAATCAGTGA

Protein Analysis

117

Amino Acids

13.54

Weight (kDa)

9.39

Isoelectric Point (pI)

55.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 182
AcoI YGGCCR 1 cut(s) 64
AcuI CTGAAG 1 cut(s) 171
AfaI GTAC 1 cut(s) 262
AgsI TTSAA 2 cut(s) 86, 134
AjiI CACGTC 1 cut(s) 158
AjnI CCWGG 2 cut(s) 95, 191
AluBI AGCT 2 cut(s) 49, 266
AluI AGCT 2 cut(s) 49, 266
Alw26I GTCTC 1 cut(s) 94
AoxI GGCC 3 cut(s) 64, 152, 194
AspS9I GGNCC 3 cut(s) 24, 152, 195
AvaII GGWCC 1 cut(s) 24
BalI TGGCCA 1 cut(s) 66
BccI CCATC 2 cut(s) 14, 222
BciT130I CCWGG 2 cut(s) 97, 193
BcoDI GTCTC 1 cut(s) 94
BfmI CTRYAG 2 cut(s) 108, 147
Bme1390I CCNGG 2 cut(s) 97, 193
Bme18I GGWCC 1 cut(s) 24
BmgBI CACGTC 1 cut(s) 158
BmgT120I GGNCC 3 cut(s) 24, 152, 195
BmiI GGNNCC 1 cut(s) 25
BmrFI CCNGG 2 cut(s) 97, 193
BsaI GGTCTC 1 cut(s) 94
BsaJI CCNNGG 1 cut(s) 95
BseBI CCWGG 2 cut(s) 97, 193
BseDI CCNNGG 1 cut(s) 95
BseGI GGATG 1 cut(s) 233
BseMII CTCAG 1 cut(s) 228
BsgI GTGCAG 1 cut(s) 327
BshFI GGCC 3 cut(s) 66, 154, 196
BslFI GGGAC 1 cut(s) 37
BsmAI GTCTC 1 cut(s) 94
BsmFI GGGAC 1 cut(s) 37
BsnI GGCC 3 cut(s) 66, 154, 196
Bso31I GGTCTC 1 cut(s) 94
BspACI CCGC 1 cut(s) 182
BspANI GGCC 3 cut(s) 66, 154, 196
BspCNI CTCAG 1 cut(s) 229
BspLI GGNNCC 1 cut(s) 25
BspTNI GGTCTC 1 cut(s) 94
BssECI CCNNGG 1 cut(s) 95
Bst2UI CCWGG 2 cut(s) 97, 193
Bst4CI ACNGT 3 cut(s) 112, 148, 300
Bst6I CTCTTC 2 cut(s) 114, 168
BstDEI CTNAG 2 cut(s) 50, 237
BstF5I GGATG 1 cut(s) 233
BstMAI GTCTC 1 cut(s) 94
BstNI CCWGG 2 cut(s) 97, 193
BstSCI CCNGG 2 cut(s) 95, 191
BstSFI CTRYAG 2 cut(s) 108, 147
BsuRI GGCC 3 cut(s) 66, 154, 196
BtrI CACGTC 1 cut(s) 158
BtsCI GGATG 1 cut(s) 233
Cfr13I GGNCC 3 cut(s) 24, 152, 195
Csp6I GTAC 1 cut(s) 261
CviAII CATG 3 cut(s) 68, 138, 211
CviJI RGCY 8 cut(s) 49, 66, 74, 154, 191, 196, 266, 335
CviKI_1 RGCY 8 cut(s) 49, 66, 74, 154, 191, 196, 266, 335
CviQI GTAC 1 cut(s) 261
DdeI CTNAG 2 cut(s) 50, 237
DraI TTTAAA 1 cut(s) 7
EaeI YGGCCR 1 cut(s) 64
Eam1104I CTCTTC 2 cut(s) 114, 168
EarI CTCTTC 2 cut(s) 114, 168
Eco31I GGTCTC 1 cut(s) 94
Eco47I GGWCC 1 cut(s) 24
Eco57I CTGAAG 1 cut(s) 171
EcoO109I RGGNCCY 1 cut(s) 24
EcoRII CCWGG 2 cut(s) 95, 191
FaeI CATG 3 cut(s) 71, 141, 214
FaiI YATR 8 cut(s) 63, 69, 139, 205, 207, 212, 269, 291
FaqI GGGAC 1 cut(s) 37
FatI CATG 3 cut(s) 67, 137, 210
FokI GGATG 1 cut(s) 240
HaeIII GGCC 3 cut(s) 66, 154, 196
Hin1II CATG 3 cut(s) 71, 141, 214
HpyAV CCTTC 3 cut(s) 121, 195, 209
HpyCH4III ACNGT 3 cut(s) 112, 148, 300
HpyCH4IV ACGT 1 cut(s) 157
HpyCH4V TGCA 1 cut(s) 308
HpyF3I CTNAG 2 cut(s) 50, 237
HpySE526I ACGT 1 cut(s) 157
Hsp92II CATG 3 cut(s) 71, 141, 214
LmnI GCTCC 1 cut(s) 46
LpnPI CCDG 6 cut(s) 28, 82, 109, 178, 205, 317
MaeII ACGT 1 cut(s) 157
MboII GAAGA 3 cut(s) 131, 155, 354
MlsI TGGCCA 1 cut(s) 66
MluCI AATT 1 cut(s) 272
MluNI TGGCCA 1 cut(s) 66
MnlI CCTC 7 cut(s) 37, 41, 64, 89, 109, 171, 270
Mox20I TGGCCA 1 cut(s) 66
MscI TGGCCA 1 cut(s) 66
MseI TTAA 1 cut(s) 6
Msp20I TGGCCA 1 cut(s) 66
MspR9I CCNGG 2 cut(s) 97, 193
MvaI CCWGG 2 cut(s) 97, 193
NlaIII CATG 3 cut(s) 71, 141, 214
NlaIV GGNNCC 1 cut(s) 25
PpuMI RGGWCCY 1 cut(s) 24
Psp5II RGGWCCY 1 cut(s) 24
Psp6I CCWGG 2 cut(s) 95, 191
PspGI CCWGG 2 cut(s) 95, 191
PspN4I GGNNCC 1 cut(s) 25
PspPI GGNCC 3 cut(s) 24, 152, 195
PspPPI RGGWCCY 1 cut(s) 24
RsaI GTAC 1 cut(s) 262
RsaNI GTAC 1 cut(s) 261
SaqAI TTAA 1 cut(s) 6
Sau96I GGNCC 3 cut(s) 24, 152, 195
ScrFI CCNGG 2 cut(s) 97, 193
SetI ASST 8 cut(s) 29, 51, 81, 109, 132, 160, 220, 268
SfcI CTRYAG 2 cut(s) 108, 147
SinI GGWCC 1 cut(s) 24
Sse9I AATT 1 cut(s) 272
SsiI CCGC 1 cut(s) 182
StyD4I CCNGG 2 cut(s) 95, 191
TaaI ACNGT 3 cut(s) 112, 148, 300
TaiI ACGT 1 cut(s) 160
TasI AATT 1 cut(s) 272
TatI WGTACW 1 cut(s) 260
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TspDTI ATGAA 1 cut(s) 140
VpaK11BI GGWCC 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.