Rh7AG050400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
3478823 .. 3479800
978 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG050400.1

Sequence Viewer

Length: 222 bp
ATGGTGATTGCATCGATCACATTGAAAAACCAGGAAATATATTCTGTCATAGAATCAGCAACAGATCAGGTTGTGAAGAACAACGAATGCTTCAATGAAGCAGAGGAGATAAGAAAAAGTTGGTTCCTGCTTCTTCTTCTACATATTGTCAATATCGGCAAAATCTTGGAAAGAATTAGTGAAAAGTCTGTTGGAAAGTTTTTAGATAATAAGGGGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.35

Weight (kDa)

6.56

Isoelectric Point (pI)

45.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0009848)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 25, 94
AjnI CCWGG 1 cut(s) 30
AjuI GAANNNNNNNTTGG 2 cut(s) 174, 206
AsuHPI GGTGA 1 cut(s) 16
BciT130I CCWGG 1 cut(s) 32
Bme1390I CCNGG 1 cut(s) 32
BmiI GGNNCC 1 cut(s) 125
BmrFI CCNGG 1 cut(s) 32
BmsI GCATC 1 cut(s) 20
Bsa29I ATCGAT 1 cut(s) 14
BseBI CCWGG 1 cut(s) 32
BseCI ATCGAT 1 cut(s) 14
BseRI GAGGAG 1 cut(s) 119
BshVI ATCGAT 1 cut(s) 14
BsmI GAATGC 1 cut(s) 92
Bsp143I GATC 2 cut(s) 15, 64
BspDI ATCGAT 1 cut(s) 14
BspLI GGNNCC 1 cut(s) 125
BssMI GATC 2 cut(s) 15, 64
Bst2UI CCWGG 1 cut(s) 32
BstKTI GATC 2 cut(s) 18, 67
BstMBI GATC 2 cut(s) 15, 64
BstNI CCWGG 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 30
Bsu15I ATCGAT 1 cut(s) 14
BsuTUI ATCGAT 1 cut(s) 14
ClaI ATCGAT 1 cut(s) 14
DpnI GATC 2 cut(s) 17, 66
DpnII GATC 2 cut(s) 15, 64
EcoRII CCWGG 1 cut(s) 30
FaiI YATR 3 cut(s) 40, 50, 144
HinfI GANTC 1 cut(s) 53
HphI GGTGA 1 cut(s) 16
HpyCH4V TGCA 1 cut(s) 11
Kzo9I GATC 2 cut(s) 15, 64
LpnPI CCDG 4 cut(s) 17, 44, 53, 140
LweI GCATC 1 cut(s) 20
MalI GATC 2 cut(s) 17, 66
MboI GATC 2 cut(s) 15, 64
MboII GAAGA 3 cut(s) 88, 125, 128
MluCI AATT 1 cut(s) 174
MmeI TCCRAC 1 cut(s) 172
MnlI CCTC 1 cut(s) 97
MspR9I CCNGG 1 cut(s) 32
Mva1269I GAATGC 1 cut(s) 92
MvaI CCWGG 1 cut(s) 32
NdeII GATC 2 cut(s) 15, 64
NlaIV GGNNCC 1 cut(s) 125
PctI GAATGC 1 cut(s) 92
PfeI GAWTC 1 cut(s) 53
Psp6I CCWGG 1 cut(s) 30
PspGI CCWGG 1 cut(s) 30
PspN4I GGNNCC 1 cut(s) 125
Sau3AI GATC 2 cut(s) 15, 64
ScrFI CCNGG 1 cut(s) 32
SetI ASST 1 cut(s) 72
SfaNI GCATC 1 cut(s) 20
SgeI CNNG 5 cut(s) 43, 44, 80, 139, 178
Sse9I AATT 1 cut(s) 174
StyD4I CCNGG 1 cut(s) 30
TaqI TCGA 1 cut(s) 14
TasI AATT 1 cut(s) 174
TfiI GAWTC 1 cut(s) 53
TspDTI ATGAA 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.