Rh7CG051700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
3776207 .. 3777065
859 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG051700.1

Sequence Viewer

Length: 324 bp
ATGGCTTTAATGGACAAGCATGGGCTTAAAAATGGAAACAACTTGTTAGTTCAGACTTATGTGCATGTGCCTGTGAAGGGAAAATCCTTTGCTTCCCTAGCTCTTCATAGATCATCGATCACATTGAAAAACCAGGAAATATATTCTGTCATAGAATTAGCAACAGATCAGGTTGTGAAGAACAGCGGATGCGTCAATGAAGCAGAGGAGATAAGAAAAAGTTGGTTCCTGCTTCTGCTTCTACATATTGTCAATATCGGCGAAATCTTGGAAAGAATTAGTGAAAAGTCTGTTGGAAAGTTTTTAGATAATAAGGGGCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

11.97

Weight (kDa)

8.76

Isoelectric Point (pI)

35.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0009848)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 186
AfiI CCNNNNNNNGG 1 cut(s) 77
AgsI TTSAA 1 cut(s) 127
AjnI CCWGG 1 cut(s) 132
AjuI GAANNNNNNNTTGG 2 cut(s) 276, 308
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
BciT130I CCWGG 1 cut(s) 134
BfaI CTAG 1 cut(s) 98
Bme1390I CCNGG 1 cut(s) 134
BmiI GGNNCC 1 cut(s) 227
BmrFI CCNGG 1 cut(s) 134
BmsI GCATC 1 cut(s) 179
Bsa29I ATCGAT 1 cut(s) 116
Bsc4I CCNNNNNNNGG 1 cut(s) 77
BseBI CCWGG 1 cut(s) 134
BseCI ATCGAT 1 cut(s) 116
BseGI GGATG 1 cut(s) 194
BseLI CCNNNNNNNGG 1 cut(s) 77
BseRI GAGGAG 1 cut(s) 221
BshVI ATCGAT 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 77
Bsp143I GATC 3 cut(s) 110, 117, 166
BspACI CCGC 1 cut(s) 186
BspDI ATCGAT 1 cut(s) 116
BspLI GGNNCC 1 cut(s) 227
BspQI GCTCTTC 1 cut(s) 108
BssMI GATC 3 cut(s) 110, 117, 166
Bst2UI CCWGG 1 cut(s) 134
Bst6I CTCTTC 1 cut(s) 108
BstF5I GGATG 1 cut(s) 194
BstKTI GATC 3 cut(s) 113, 120, 169
BstMBI GATC 3 cut(s) 110, 117, 166
BstMWI GCNNNNNNNGC 1 cut(s) 98
BstNI CCWGG 1 cut(s) 134
BstNSI RCATGY 1 cut(s) 68
BstSCI CCNGG 1 cut(s) 132
Bsu15I ATCGAT 1 cut(s) 116
BsuTUI ATCGAT 1 cut(s) 116
BtsCI GGATG 1 cut(s) 194
ClaI ATCGAT 1 cut(s) 116
CseI GACGC 1 cut(s) 181
CviAII CATG 2 cut(s) 20, 65
CviJI RGCY 3 cut(s) 5, 25, 101
CviKI_1 RGCY 3 cut(s) 5, 25, 101
DpnI GATC 3 cut(s) 112, 119, 168
DpnII GATC 3 cut(s) 110, 117, 166
Eam1104I CTCTTC 1 cut(s) 108
EarI CTCTTC 1 cut(s) 108
EcoRII CCWGG 1 cut(s) 132
FaeI CATG 2 cut(s) 23, 68
FaiI YATR 7 cut(s) 21, 60, 66, 108, 142, 152, 246
FatI CATG 2 cut(s) 19, 64
FokI GGATG 1 cut(s) 201
FspBI CTAG 1 cut(s) 98
HgaI GACGC 1 cut(s) 181
Hin1II CATG 2 cut(s) 23, 68
Hpy188I TCNGA 1 cut(s) 54
HpyAV CCTTC 1 cut(s) 70
HpyCH4V TGCA 1 cut(s) 64
HpyF10VI GCNNNNNNNGC 1 cut(s) 98
Hsp92II CATG 2 cut(s) 23, 68
Kzo9I GATC 3 cut(s) 110, 117, 166
LguI GCTCTTC 1 cut(s) 108
LpnPI CCDG 5 cut(s) 84, 119, 146, 155, 242
LweI GCATC 1 cut(s) 179
MaeI CTAG 1 cut(s) 98
MalI GATC 3 cut(s) 112, 119, 168
MboI GATC 3 cut(s) 110, 117, 166
MboII GAAGA 2 cut(s) 95, 190
MluCI AATT 2 cut(s) 155, 276
MmeI TCCRAC 1 cut(s) 274
MnlI CCTC 1 cut(s) 199
MseI TTAA 2 cut(s) 8, 27
MspA1I CMGCKG 1 cut(s) 186
MspR9I CCNGG 1 cut(s) 134
MvaI CCWGG 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 98
NdeII GATC 3 cut(s) 110, 117, 166
NlaIII CATG 2 cut(s) 23, 68
NlaIV GGNNCC 1 cut(s) 227
NspI RCATGY 1 cut(s) 68
PciSI GCTCTTC 1 cut(s) 108
Psp6I CCWGG 1 cut(s) 132
PspGI CCWGG 1 cut(s) 132
PspN4I GGNNCC 1 cut(s) 227
SapI GCTCTTC 1 cut(s) 108
SaqAI TTAA 2 cut(s) 8, 27
Sau3AI GATC 3 cut(s) 110, 117, 166
ScrFI CCNGG 1 cut(s) 134
SetI ASST 2 cut(s) 103, 174
SfaNI GCATC 1 cut(s) 179
Sse9I AATT 2 cut(s) 155, 276
SsiI CCGC 1 cut(s) 186
SspMI CTAG 1 cut(s) 98
StyD4I CCNGG 1 cut(s) 132
TaqI TCGA 1 cut(s) 116
TasI AATT 2 cut(s) 155, 276
Tru1I TTAA 2 cut(s) 8, 27
Tru9I TTAA 2 cut(s) 8, 27
TspDTI ATGAA 2 cut(s) 95, 213
XceI RCATGY 1 cut(s) 68
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.