Rh7CG233400

Plant protein of unknown function

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0010305
Physical Location & Seq
Reverse (-)
21790433 .. 21790792
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG233400.1

Sequence Viewer

Length: 360 bp
ATGGAAGAGGAAAAAAATAGGTATCTTCAACATTATCTCTGTGGGACAGAAAGAGCATCAGAGGATTACTCTACAAGTAAAATAAAAGATCAAGAAGCAAGACTGCGCAGCTGTTACTCGGAGACTATTGAGTTTAATAGCGATGAACTTGTGAGAATCATTCTAGTCGATGCTGTGTTCATCATTGAGATCTTTCTGAGGTATTATTTACCCGAATTGCAGGATGGGAATGACTACATATTGACAGATCCCCATTGGTTACAAGGTGTTTCTTGTGACTTGGGGTTCCTCGAAAATCAATTGCCGTTATTCATTCTTGAGGATTTTTTGACCAAACATAATCAATTGTGTTGGGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF247

Protein Analysis

119

Amino Acids

14.18

Weight (kDa)

4.44

Isoelectric Point (pI)

69.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF247 PF03140 1 - 110 1.2e-25 Plant protein of unknown function
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 107
AclWI GGATC 1 cut(s) 242
AgsI TTSAA 1 cut(s) 29
AluBI AGCT 1 cut(s) 111
AluI AGCT 1 cut(s) 111
Alw26I GTCTC 1 cut(s) 116
AlwI GGATC 1 cut(s) 242
ApeKI GCWGC 1 cut(s) 108
AspLEI GCGC 1 cut(s) 108
BbvI GCAGC 1 cut(s) 120
BccI CCATC 1 cut(s) 218
BceAI ACGGC 1 cut(s) 289
BcoDI GTCTC 1 cut(s) 116
BfaI CTAG 1 cut(s) 164
BglII AGATCT 1 cut(s) 189
BisI GCNGC 1 cut(s) 109
BlsI GCNGC 1 cut(s) 110
BmiI GGNNCC 1 cut(s) 287
BmsI GCATC 2 cut(s) 65, 160
BplI GAGNNNNNCTC 2 cut(s) 53, 85
BpuEI CTTGAG 1 cut(s) 338
BseGI GGATG 1 cut(s) 229
BseMII CTCAG 1 cut(s) 188
BseXI GCAGC 1 cut(s) 120
BslFI GGGAC 1 cut(s) 58
BsmAI GTCTC 1 cut(s) 116
BsmFI GGGAC 1 cut(s) 58
Bsp143I GATC 3 cut(s) 88, 189, 247
BspCNI CTCAG 1 cut(s) 189
BspLI GGNNCC 1 cut(s) 287
BspPI GGATC 1 cut(s) 242
BssMI GATC 3 cut(s) 88, 189, 247
BstDEI CTNAG 1 cut(s) 197
BstF5I GGATG 1 cut(s) 229
BstHHI GCGC 1 cut(s) 108
BstKTI GATC 3 cut(s) 91, 192, 250
BstMAI GTCTC 1 cut(s) 116
BstMBI GATC 3 cut(s) 88, 189, 247
BstV1I GCAGC 1 cut(s) 120
BstX2I RGATCY 2 cut(s) 189, 247
BstYI RGATCY 2 cut(s) 189, 247
BtgZI GCGATG 1 cut(s) 156
BtsCI GGATG 1 cut(s) 229
CfoI GCGC 1 cut(s) 108
CviJI RGCY 1 cut(s) 111
CviKI_1 RGCY 1 cut(s) 111
DdeI CTNAG 1 cut(s) 197
DpnI GATC 3 cut(s) 90, 191, 249
DpnII GATC 3 cut(s) 88, 189, 247
FaiI YATR 2 cut(s) 239, 339
FaqI GGGAC 1 cut(s) 58
Fnu4HI GCNGC 1 cut(s) 109
FokI GGATG 1 cut(s) 236
Fsp4HI GCNGC 1 cut(s) 109
FspBI CTAG 1 cut(s) 164
FspI TGCGCA 1 cut(s) 107
GlaI GCGC 1 cut(s) 107
GluI GCNGC 1 cut(s) 109
HhaI GCGC 1 cut(s) 108
Hin6I GCGC 1 cut(s) 106
HinP1I GCGC 1 cut(s) 106
HinfI GANTC 1 cut(s) 156
Hpy188I TCNGA 3 cut(s) 61, 121, 198
Hpy188III TCNNGA 2 cut(s) 92, 317
HpyCH4V TGCA 1 cut(s) 220
HpyF3I CTNAG 1 cut(s) 197
HspAI GCGC 1 cut(s) 106
Kzo9I GATC 3 cut(s) 88, 189, 247
LpnPI CCDG 1 cut(s) 206
Lsp1109I GCAGC 1 cut(s) 120
LweI GCATC 2 cut(s) 65, 160
MaeI CTAG 1 cut(s) 164
MaeIII GTNAC 3 cut(s) 113, 258, 275
MalI GATC 3 cut(s) 90, 191, 249
MboI GATC 3 cut(s) 88, 189, 247
MboII GAAGA 2 cut(s) 17, 17
MfeI CAATTG 2 cut(s) 299, 344
MflI RGATCY 2 cut(s) 189, 247
MluCI AATT 3 cut(s) 215, 299, 344
MnlI CCTC 4 cut(s) 55, 192, 299, 313
MseI TTAA 1 cut(s) 135
MspA1I CMGCKG 1 cut(s) 111
MunI CAATTG 2 cut(s) 299, 344
NdeII GATC 3 cut(s) 88, 189, 247
NlaIV GGNNCC 1 cut(s) 287
NmuCI GTSAC 1 cut(s) 275
NsbI TGCGCA 1 cut(s) 107
PfeI GAWTC 1 cut(s) 156
PkrI GCNGC 1 cut(s) 110
PspN4I GGNNCC 1 cut(s) 287
PsuI RGATCY 2 cut(s) 189, 247
PvuII CAGCTG 1 cut(s) 111
SaqAI TTAA 1 cut(s) 135
SatI GCNGC 1 cut(s) 109
Sau3AI GATC 3 cut(s) 88, 189, 247
SetI ASST 4 cut(s) 23, 113, 203, 268
SfaNI GCATC 2 cut(s) 65, 160
SmlI CTYRAG 1 cut(s) 317
SmoI CTYRAG 1 cut(s) 317
Sse9I AATT 3 cut(s) 215, 299, 344
SspMI CTAG 1 cut(s) 164
TaqI TCGA 2 cut(s) 168, 291
TasI AATT 3 cut(s) 215, 299, 344
TfiI GAWTC 1 cut(s) 156
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TseFI GTSAC 1 cut(s) 275
TseI GCWGC 1 cut(s) 108
Tsp45I GTSAC 1 cut(s) 275
TspDTI ATGAA 3 cut(s) 159, 169, 301
XspI CTAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.