Rh7DG276300

Secretory carrier-associated membrane protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0007929
Physical Location & Seq
Forward (+)
29787878 .. 29797164
9287 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG276300.1

Sequence Viewer

Length: 573 bp
ATGTGCCATAATTTGATAAATATGCAGAATGGGAAGTCACGGATTCCACCATTGGCATCTGAACCTCTTGGTTTTGGGCAGAAACATGATGCAACAGTTGATATACCATTGGACACAATGAGTGATTCTAAGCAAAAGGCAAAAGAGCTTGCAACCTGGGAAGCAGATCTCAAGAGAAGAGAAAAGGATATCAAACGAAGAGAGGATTCTGTTGCAAAAGCTGGTGTCCCCGATGATGGGAAAAATTGGCCTCCATTCTTTCCGATTATTCACCATGATATTGCCAATGAAATTCCTGTACATGCTCAAAGACTACAGTATATGGCTTTTGCAAGTTGGTTAGGTATAGTTCTTTGCCTAGTGTTCAATGTAATTGCTGTTATCATCTGTTGGGTTAGAGGAGGAGGTTCCAAAATATTTTTCCTTGCAGTCATCTATGCTTTACTTGGAATACCACTCTCATATGTGCTGTGGTACAGGCCCCTCTATCGGGCAATGAGGACAGATAGTGCCTTGAAGTTTGGTTGGTTTTTCCTGTTCTACATGGTATGTACTGATACAATATTCTTTTGA

Protein Analysis

190

Amino Acids

21.75

Weight (kDa)

8.88

Isoelectric Point (pI)

45.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SCAMP PF04144 81 - 183 2.9e-40 SCAMP family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 291
AfaI GTAC 3 cut(s) 300, 476, 553
AfiI CCNNNNNNNGG 4 cut(s) 236, 237, 489, 490
AgsI TTSAA 2 cut(s) 367, 517
AjnI CCWGG 1 cut(s) 155
AjuI GAANNNNNNNTTGG 2 cut(s) 404, 436
AluBI AGCT 2 cut(s) 148, 221
AluI AGCT 2 cut(s) 148, 221
AoxI GGCC 2 cut(s) 248, 479
ApoI RAATTY 1 cut(s) 291
AspS9I GGNCC 1 cut(s) 480
AsuHPI GGTGA 1 cut(s) 263
BccI CCATC 1 cut(s) 230
BciT130I CCWGG 1 cut(s) 157
BfaI CTAG 1 cut(s) 359
BfmI CTRYAG 1 cut(s) 314
BglII AGATCT 1 cut(s) 166
Bme1390I CCNGG 1 cut(s) 157
BmgT120I GGNCC 1 cut(s) 480
BmiI GGNNCC 2 cut(s) 409, 482
BmrFI CCNGG 1 cut(s) 157
BmsI GCATC 2 cut(s) 65, 79
BpuEI CTTGAG 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 156
Bsc4I CCNNNNNNNGG 4 cut(s) 236, 237, 489, 490
Bse3DI GCAATG 1 cut(s) 501
BseBI CCWGG 1 cut(s) 157
BseDI CCNNGG 1 cut(s) 156
BseLI CCNNNNNNNGG 4 cut(s) 236, 237, 489, 490
BseMI GCAATG 1 cut(s) 501
BseRI GAGGAG 2 cut(s) 414, 417
BshFI GGCC 2 cut(s) 250, 481
BslFI GGGAC 1 cut(s) 212
BslI CCNNNNNNNGG 4 cut(s) 236, 237, 489, 490
BsmFI GGGAC 1 cut(s) 212
BsnI GGCC 2 cut(s) 250, 481
Bsp1407I TGTACA 1 cut(s) 298
Bsp143I GATC 1 cut(s) 166
BspANI GGCC 2 cut(s) 250, 481
BspLI GGNNCC 2 cut(s) 409, 482
BsrDI GCAATG 1 cut(s) 501
BsrGI TGTACA 1 cut(s) 298
BssECI CCNNGG 1 cut(s) 156
BssMI GATC 1 cut(s) 166
Bst2UI CCWGG 1 cut(s) 157
Bst4CI ACNGT 2 cut(s) 97, 318
Bst6I CTCTTC 2 cut(s) 172, 193
BstAUI TGTACA 1 cut(s) 298
BstC8I GCNNGC 1 cut(s) 150
BstDEI CTNAG 1 cut(s) 129
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BstNI CCWGG 1 cut(s) 157
BstNSI RCATGY 1 cut(s) 305
BstSCI CCNGG 1 cut(s) 155
BstSFI CTRYAG 1 cut(s) 314
BstX2I RGATCY 1 cut(s) 166
BstYI RGATCY 1 cut(s) 166
BsuRI GGCC 2 cut(s) 250, 481
Cac8I GCNNGC 1 cut(s) 150
Cfr13I GGNCC 1 cut(s) 480
Csp6I GTAC 3 cut(s) 299, 475, 552
CviAII CATG 4 cut(s) 86, 275, 302, 544
CviJI RGCY 5 cut(s) 148, 221, 250, 326, 481
CviKI_1 RGCY 5 cut(s) 148, 221, 250, 326, 481
CviQI GTAC 3 cut(s) 299, 475, 552
DdeI CTNAG 1 cut(s) 129
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
Eam1104I CTCTTC 2 cut(s) 172, 193
EarI CTCTTC 2 cut(s) 172, 193
Eco32I GATATC 1 cut(s) 190
EcoO109I RGGNCCY 1 cut(s) 480
EcoRII CCWGG 1 cut(s) 155
EcoRV GATATC 1 cut(s) 190
FaeI CATG 4 cut(s) 89, 278, 305, 547
FaqI GGGAC 1 cut(s) 212
FatI CATG 4 cut(s) 85, 274, 301, 543
FauNDI CATATG 1 cut(s) 463
FspBI CTAG 1 cut(s) 359
HaeIII GGCC 2 cut(s) 250, 481
Hin1II CATG 4 cut(s) 89, 278, 305, 547
HinfI GANTC 3 cut(s) 43, 125, 206
HphI GGTGA 1 cut(s) 263
Hpy188I TCNGA 2 cut(s) 61, 264
Hpy188III TCNNGA 1 cut(s) 172
HpyCH4III ACNGT 2 cut(s) 97, 318
HpyCH4V TGCA 6 cut(s) 25, 92, 152, 215, 332, 428
HpyF3I CTNAG 1 cut(s) 129
Hsp92II CATG 4 cut(s) 89, 278, 305, 547
Kzo9I GATC 1 cut(s) 166
LpnPI CCDG 6 cut(s) 142, 169, 207, 309, 463, 548
LweI GCATC 2 cut(s) 65, 79
MaeI CTAG 1 cut(s) 359
MaeIII GTNAC 1 cut(s) 36
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MboII GAAGA 2 cut(s) 189, 210
MflI RGATCY 1 cut(s) 166
MluCI AATT 4 cut(s) 10, 244, 291, 372
MnlI CCTC 8 cut(s) 75, 196, 261, 392, 395, 398, 492, 494
MspR9I CCNGG 1 cut(s) 157
MvaI CCWGG 1 cut(s) 157
NdeI CATATG 1 cut(s) 463
NdeII GATC 1 cut(s) 166
NlaIII CATG 4 cut(s) 89, 278, 305, 547
NlaIV GGNNCC 2 cut(s) 409, 482
NmuCI GTSAC 1 cut(s) 36
NspI RCATGY 1 cut(s) 305
PfeI GAWTC 3 cut(s) 43, 125, 206
Psp6I CCWGG 1 cut(s) 155
PspGI CCWGG 1 cut(s) 155
PspN4I GGNNCC 2 cut(s) 409, 482
PspPI GGNCC 1 cut(s) 480
PsuI RGATCY 1 cut(s) 166
RsaI GTAC 3 cut(s) 300, 476, 553
RsaNI GTAC 3 cut(s) 299, 475, 552
Sau3AI GATC 1 cut(s) 166
Sau96I GGNCC 1 cut(s) 480
ScrFI CCNGG 1 cut(s) 157
SetI ASST 6 cut(s) 67, 150, 158, 223, 346, 409
SfaNI GCATC 2 cut(s) 65, 79
SfcI CTRYAG 1 cut(s) 314
SmlI CTYRAG 1 cut(s) 170
SmoI CTYRAG 1 cut(s) 170
Sse9I AATT 4 cut(s) 10, 244, 291, 372
SspI AATATT 2 cut(s) 417, 564
SspMI CTAG 1 cut(s) 359
StyD4I CCNGG 1 cut(s) 155
TaaI ACNGT 2 cut(s) 97, 318
TasI AATT 4 cut(s) 10, 244, 291, 372
TatI WGTACW 2 cut(s) 298, 551
TfiI GAWTC 3 cut(s) 43, 125, 206
TseFI GTSAC 1 cut(s) 36
Tsp45I GTSAC 1 cut(s) 36
TspDTI ATGAA 1 cut(s) 303
TspGWI ACGGA 1 cut(s) 55
XapI RAATTY 1 cut(s) 291
XceI RCATGY 1 cut(s) 305
XspI CTAG 1 cut(s) 359
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.