Rw1G003970

Anaphase-promoting complex subunit

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Forward (+)
7446745 .. 7451641
4897 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G003970.1

Sequence Viewer

Length: 276 bp
ATGATATTTCTGTCTGTGTTTCGTTGGGTTTCAGTATTCTGGTGGCATGCTGTTGCTGCATGGACATGGGATGCTCAGGACGAAACATGTGGCATTTGTAGGATGGCATTTGATGGTTGTTGTCCTGATTGTAAGCTCCCTGGGGATGATTGTCCACTAATTTGGGGTGCATGCAACCATGCATTTCATCTTCATTGCATCCTAAAATGGGTAAATTCACAGACTTCTCAAGCACATTGCCCCATGTGCCGGAGGGAGTGGCAGTTCAAAGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.61

Weight (kDa)

6.47

Isoelectric Point (pI)

31.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-ANAPC11 PF12861 27 - 90 2.4e-35 Anaphase-promoting complex subunit 11 RING-H2 finger
zf-rbx1 PF12678 28 - 84 5.9e-22 RING-H2 zinc finger domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 214
AfiI CCNNNNNNNGG 2 cut(s) 208, 249
AflIII ACRYGT 1 cut(s) 86
AgsI TTSAA 1 cut(s) 268
AjnI CCWGG 1 cut(s) 139
AloI GAACNNNNNNTCC 1 cut(s) 248
AluBI AGCT 1 cut(s) 136
AluI AGCT 1 cut(s) 136
ApeKI GCWGC 1 cut(s) 56
ApoI RAATTY 1 cut(s) 214
BbvI GCAGC 1 cut(s) 43
BccI CCATC 2 cut(s) 97, 107
BciT130I CCWGG 1 cut(s) 141
BisI GCNGC 1 cut(s) 57
BlsI GCNGC 1 cut(s) 58
Bme1390I CCNGG 1 cut(s) 141
BmrFI CCNGG 1 cut(s) 141
BmsI GCATC 2 cut(s) 61, 207
Bpu10I CCTNAGC 1 cut(s) 75
BpuEI CTTGAG 1 cut(s) 213
BsaJI CCNNGG 2 cut(s) 139, 140
BsaXI ACNNNNNCTCC 1 cut(s) 248
Bsc4I CCNNNNNNNGG 2 cut(s) 208, 249
Bse3DI GCAATG 2 cut(s) 193, 235
BseBI CCWGG 1 cut(s) 141
BseDI CCNNGG 2 cut(s) 139, 140
BseGI GGATG 4 cut(s) 76, 108, 151, 198
BseLI CCNNNNNNNGG 2 cut(s) 208, 249
BseMI GCAATG 2 cut(s) 193, 235
BseMII CTCAG 1 cut(s) 89
BseXI GCAGC 1 cut(s) 43
BsiSI CCGG 1 cut(s) 250
BslI CCNNNNNNNGG 2 cut(s) 208, 249
BspCNI CTCAG 1 cut(s) 88
BsrDI GCAATG 2 cut(s) 193, 235
BssECI CCNNGG 2 cut(s) 139, 140
Bst2UI CCWGG 1 cut(s) 141
BstC8I GCNNGC 2 cut(s) 48, 172
BstDEI CTNAG 1 cut(s) 75
BstF5I GGATG 4 cut(s) 76, 108, 151, 198
BstMWI GCNNNNNNNGC 2 cut(s) 56, 246
BstNI CCWGG 1 cut(s) 141
BstNSI RCATGY 3 cut(s) 50, 90, 174
BstSCI CCNGG 1 cut(s) 139
BstV1I GCAGC 1 cut(s) 43
BstXI CCANNNNNNTGG 1 cut(s) 162
BtsCI GGATG 4 cut(s) 76, 108, 151, 198
Cac8I GCNNGC 2 cut(s) 48, 172
CviAII CATG 7 cut(s) 47, 60, 66, 87, 171, 179, 244
CviJI RGCY 1 cut(s) 136
CviKI_1 RGCY 1 cut(s) 136
DdeI CTNAG 1 cut(s) 75
EcoRII CCWGG 1 cut(s) 139
EcoT22I ATGCAT 1 cut(s) 184
FaeI CATG 7 cut(s) 50, 63, 69, 90, 174, 182, 247
FaiI YATR 7 cut(s) 48, 61, 67, 88, 172, 180, 245
FatI CATG 7 cut(s) 46, 59, 65, 86, 170, 178, 243
Fnu4HI GCNGC 1 cut(s) 57
FokI GGATG 4 cut(s) 83, 115, 158, 185
Fsp4HI GCNGC 1 cut(s) 57
GluI GCNGC 1 cut(s) 57
HapII CCGG 1 cut(s) 250
Hin1II CATG 7 cut(s) 50, 63, 69, 90, 174, 182, 247
HpaII CCGG 1 cut(s) 250
Hpy166II GTNNAC 1 cut(s) 155
Hpy188III TCNNGA 2 cut(s) 77, 125
Hpy8I GTNNAC 1 cut(s) 155
HpyCH4V TGCA 5 cut(s) 59, 170, 174, 182, 198
HpyF10VI GCNNNNNNNGC 2 cut(s) 56, 246
HpyF3I CTNAG 1 cut(s) 75
Hsp92II CATG 7 cut(s) 50, 63, 69, 90, 174, 182, 247
LmnI GCTCC 1 cut(s) 141
LpnPI CCDG 6 cut(s) 25, 62, 126, 138, 153, 263
Lsp1109I GCAGC 1 cut(s) 43
LweI GCATC 2 cut(s) 61, 207
MboII GAAGA 1 cut(s) 182
MluCI AATT 2 cut(s) 159, 214
MnlI CCTC 1 cut(s) 246
Mph1103I ATGCAT 1 cut(s) 184
MslI CAYNNNNRTG 1 cut(s) 64
MspI CCGG 1 cut(s) 250
MspR9I CCNGG 1 cut(s) 141
MvaI CCWGG 1 cut(s) 141
MwoI GCNNNNNNNGC 2 cut(s) 56, 246
NlaIII CATG 7 cut(s) 50, 63, 69, 90, 174, 182, 247
NsiI ATGCAT 1 cut(s) 184
NspI RCATGY 3 cut(s) 50, 90, 174
PaeI GCATGC 2 cut(s) 50, 174
PasI CCCWGGG 1 cut(s) 140
PciI ACATGT 1 cut(s) 86
PkrI GCNGC 1 cut(s) 58
PscI ACATGT 1 cut(s) 86
Psp6I CCWGG 1 cut(s) 139
PspGI CCWGG 1 cut(s) 139
RseI CAYNNNNRTG 1 cut(s) 64
SatI GCNGC 1 cut(s) 57
ScrFI CCNGG 1 cut(s) 141
SetI ASST 1 cut(s) 138
SfaNI GCATC 2 cut(s) 61, 207
SmiMI CAYNNNNRTG 1 cut(s) 64
SmlI CTYRAG 1 cut(s) 228
SmoI CTYRAG 1 cut(s) 228
SphI GCATGC 2 cut(s) 50, 174
Sse9I AATT 2 cut(s) 159, 214
StyD4I CCNGG 1 cut(s) 139
TasI AATT 2 cut(s) 159, 214
TseI GCWGC 1 cut(s) 56
TspDTI ATGAA 2 cut(s) 176, 182
XapI RAATTY 1 cut(s) 214
XceI RCATGY 3 cut(s) 50, 90, 174
Zsp2I ATGCAT 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.