Rw5G048460

Catalyzes the isomerization of citrate to isocitrate via cis-aconitate

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Reverse (-)
84269170 .. 84269887
718 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G048460.1

Sequence Viewer

Length: 339 bp
ATGTTCCTGCATCACCCACCCCACGAAACCCTCCCTTCGCTGACAGACCCAAGGATCGATAAGTTACCGTACTCTGTCAGAATCCTGCTTGAATGTGCTATTCGCAATTGTGATAACTTCCAAGAAAAGAAGGAAGATGTTGAGAAAATTCTTGCCTGGGAAAATACTGTTCCAAAGCAAGTTGAAATTCCTTTCAAGCCTGCTCGTGTACTCTTGCAGGACTTTACAGGAGTGGCAGACCTTGCTGTAATGCGTGATGCTATGAACAATCTTGGCAGTGATTCTAACAAGATCAATCCCTTGGTTCCTGTTGATCTTCTTGTTGATCACTCCGTTTAA

Protein Analysis

112

Amino Acids

12.73

Weight (kDa)

5.23

Isoelectric Point (pI)

36.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Aconitase PF00330 48 - 112 1.5e-08 Aconitase family (aconitate hydratase)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 62
AcsI RAATTY 2 cut(s) 147, 186
AfaI GTAC 2 cut(s) 71, 210
AgsI TTSAA 3 cut(s) 92, 185, 196
AjnI CCWGG 1 cut(s) 155
AlwI GGATC 1 cut(s) 62
ApoI RAATTY 2 cut(s) 147, 186
AsuHPI GGTGA 1 cut(s) 5
BauI CACGAG 1 cut(s) 204
BciT130I CCWGG 1 cut(s) 157
BclI TGATCA 1 cut(s) 325
Bme1390I CCNGG 1 cut(s) 157
BmiI GGNNCC 1 cut(s) 306
BmrFI CCNGG 1 cut(s) 157
BmsI GCATC 2 cut(s) 19, 247
Bsa29I ATCGAT 1 cut(s) 57
BsaJI CCNNGG 3 cut(s) 50, 156, 300
BseBI CCWGG 1 cut(s) 157
BseCI ATCGAT 1 cut(s) 57
BseDI CCNNGG 3 cut(s) 50, 156, 300
BshVI ATCGAT 1 cut(s) 57
Bsp143I GATC 4 cut(s) 54, 291, 313, 325
BspDI ATCGAT 1 cut(s) 57
BspLI GGNNCC 1 cut(s) 306
BspPI GGATC 1 cut(s) 62
BssECI CCNNGG 3 cut(s) 50, 156, 300
BssMI GATC 4 cut(s) 54, 291, 313, 325
BssSI CACGAG 1 cut(s) 204
BssT1I CCWWGG 2 cut(s) 50, 300
Bst2BI CACGAG 1 cut(s) 204
Bst2UI CCWGG 1 cut(s) 157
Bst4CI ACNGT 2 cut(s) 69, 169
BstAPI GCANNNNNTGC 1 cut(s) 242
BstC8I GCNNGC 1 cut(s) 201
BstKTI GATC 4 cut(s) 57, 294, 316, 328
BstMBI GATC 4 cut(s) 54, 291, 313, 325
BstMWI GCNNNNNNNGC 1 cut(s) 242
BstNI CCWGG 1 cut(s) 157
BstSCI CCNGG 1 cut(s) 155
Bsu15I ATCGAT 1 cut(s) 57
BsuTUI ATCGAT 1 cut(s) 57
BtsI GCAGTG 1 cut(s) 283
BtsIMutI CAGTG 1 cut(s) 283
Cac8I GCNNGC 1 cut(s) 201
ClaI ATCGAT 1 cut(s) 57
Csp6I GTAC 2 cut(s) 70, 209
CviJI RGCY 1 cut(s) 199
CviKI_1 RGCY 1 cut(s) 199
CviQI GTAC 2 cut(s) 70, 209
DpnI GATC 4 cut(s) 56, 293, 315, 327
DpnII GATC 4 cut(s) 54, 291, 313, 325
Eco130I CCWWGG 2 cut(s) 50, 300
EcoRII CCWGG 1 cut(s) 155
EcoT14I CCWWGG 2 cut(s) 50, 300
ErhI CCWWGG 2 cut(s) 50, 300
FaiI YATR 1 cut(s) 263
FbaI TGATCA 1 cut(s) 325
HinfI GANTC 2 cut(s) 81, 281
HphI GGTGA 1 cut(s) 5
Hpy166II GTNNAC 1 cut(s) 209
Hpy188I TCNGA 1 cut(s) 80
Hpy8I GTNNAC 1 cut(s) 209
HpyAV CCTTC 2 cut(s) 45, 124
HpyCH4III ACNGT 2 cut(s) 69, 169
HpyCH4V TGCA 2 cut(s) 10, 217
HpyF10VI GCNNNNNNNGC 1 cut(s) 242
Ksp22I TGATCA 1 cut(s) 325
Kzo9I GATC 4 cut(s) 54, 291, 313, 325
LpnPI CCDG 8 cut(s) 20, 98, 142, 169, 203, 213, 213, 321
LweI GCATC 2 cut(s) 19, 247
MaeIII GTNAC 1 cut(s) 63
MalI GATC 4 cut(s) 56, 293, 315, 327
MboI GATC 4 cut(s) 54, 291, 313, 325
MboII GAAGA 2 cut(s) 146, 308
MfeI CAATTG 1 cut(s) 106
MluCI AATT 3 cut(s) 106, 147, 186
MnlI CCTC 1 cut(s) 41
MseI TTAA 1 cut(s) 337
MspR9I CCNGG 1 cut(s) 157
MunI CAATTG 1 cut(s) 106
MvaI CCWGG 1 cut(s) 157
MwoI GCNNNNNNNGC 1 cut(s) 242
NdeII GATC 4 cut(s) 54, 291, 313, 325
NlaIV GGNNCC 1 cut(s) 306
PfeI GAWTC 2 cut(s) 81, 281
Psp6I CCWGG 1 cut(s) 155
PspGI CCWGG 1 cut(s) 155
PspN4I GGNNCC 1 cut(s) 306
RsaI GTAC 2 cut(s) 71, 210
RsaNI GTAC 2 cut(s) 70, 209
SaqAI TTAA 1 cut(s) 337
Sau3AI GATC 4 cut(s) 54, 291, 313, 325
ScrFI CCNGG 1 cut(s) 157
SetI ASST 1 cut(s) 243
SfaNI GCATC 2 cut(s) 19, 247
Sse9I AATT 3 cut(s) 106, 147, 186
StyD4I CCNGG 1 cut(s) 155
StyI CCWWGG 2 cut(s) 50, 300
TaaI ACNGT 2 cut(s) 69, 169
TaqI TCGA 1 cut(s) 57
TasI AATT 3 cut(s) 106, 147, 186
TatI WGTACW 1 cut(s) 208
TfiI GAWTC 2 cut(s) 81, 281
Tru1I TTAA 1 cut(s) 337
Tru9I TTAA 1 cut(s) 337
TscAI CASTG 1 cut(s) 283
TspDTI ATGAA 1 cut(s) 278
TspGWI ACGGA 1 cut(s) 322
TspRI CASTG 1 cut(s) 283
XapI RAATTY 2 cut(s) 147, 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.