AT1G20065

DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
6956374 .. 6958075
1702 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G20065.5

Sequence Viewer

Length: 192 bp
ATGGAGAAATCTCGTGAAAGTGATATCTTGTTCTGTAATTTGTGTGGGACAATGCTGGTCTTGAAATCAACCAAGTATGCAGAATGTCCACTATGCGAAACAACGCGAAATGGCAAAGAAATCATTGACAAGAATTTAGCTTACACAGTTACTACTGAGGATATCAGAAGAGAACTAGGAATATCAGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

7.18

Weight (kDa)

5.1

Isoelectric Point (pI)

44.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 106
AcsI RAATTY 1 cut(s) 133
AgsI TTSAA 1 cut(s) 64
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
ApoI RAATTY 1 cut(s) 133
BauI CACGAG 1 cut(s) 12
BfaI CTAG 1 cut(s) 176
BseMII CTCAG 1 cut(s) 147
Bsh1236I CGCG 1 cut(s) 106
BslFI GGGAC 1 cut(s) 61
BsmFI GGGAC 1 cut(s) 61
BspCNI CTCAG 1 cut(s) 148
BspFNI CGCG 1 cut(s) 106
BssSI CACGAG 1 cut(s) 12
Bst2BI CACGAG 1 cut(s) 12
Bst4CI ACNGT 1 cut(s) 148
Bst6I CTCTTC 1 cut(s) 163
BstDEI CTNAG 1 cut(s) 156
BstFNI CGCG 1 cut(s) 106
BstUI CGCG 1 cut(s) 106
CviJI RGCY 1 cut(s) 140
CviKI_1 RGCY 1 cut(s) 140
DdeI CTNAG 1 cut(s) 156
Eam1104I CTCTTC 1 cut(s) 163
EarI CTCTTC 1 cut(s) 163
Eco32I GATATC 2 cut(s) 25, 163
EcoRV GATATC 2 cut(s) 25, 163
FaiI YATR 2 cut(s) 78, 94
FaqI GGGAC 1 cut(s) 61
FspBI CTAG 1 cut(s) 176
FspEI CC 8 cut(s) 30, 31, 41, 85, 96, 102, 143, 162
Hpy166II GTNNAC 1 cut(s) 89
Hpy188I TCNGA 2 cut(s) 167, 187
Hpy188III TCNNGA 2 cut(s) 14, 61
Hpy8I GTNNAC 1 cut(s) 89
HpyCH4III ACNGT 1 cut(s) 148
HpyCH4V TGCA 1 cut(s) 80
HpyF3I CTNAG 1 cut(s) 156
LpnPI CCDG 1 cut(s) 41
MaeI CTAG 1 cut(s) 176
MaeIII GTNAC 1 cut(s) 148
MboII GAAGA 1 cut(s) 180
MluCI AATT 2 cut(s) 37, 133
MnlI CCTC 1 cut(s) 151
MvnI CGCG 1 cut(s) 106
SetI ASST 1 cut(s) 142
SgeI CNNG 9 cut(s) 24, 26, 40, 68, 73, 85, 117, 142, 188
Sse9I AATT 2 cut(s) 37, 133
SspMI CTAG 1 cut(s) 176
TaaI ACNGT 1 cut(s) 148
TasI AATT 2 cut(s) 37, 133
XapI RAATTY 1 cut(s) 133
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.