Rorug02G0248600

DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
25917334 .. 25919897
2564 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0248600.1

Sequence Viewer

Length: 459 bp
ATGCTGAGTTTCTTGTTTGATGATACTTTTGTCATCGAGAAGCTGGACCCGGATGGTAAAAAGTTTGACAAAGTTTCTCGAATTGTAGCACGGAGTGAGAAGCATGGTGCTGTGCTGCACCTAGATGTGAATACAGAGGTATACCCTATGCATGAGAAGGAGAAGTTCTTGATGGTGCTGTCTCCTACGCTTAACTACAGTGGAGCACCTGTTACGAACCAGGCACAGGTTGAACAGAAGTCTCTTGCAGACAAGTTTGAATATATCATGCATGGTTTGCTGTATAAAATGGATCACATGAGATCAGAACCTTCAGATGGAGGCTCAAAGTCGCCACCCGTAGTGGAGGTATTTGTTTCTTTTGGTGGGCTACAGATGAGGCTGAGAGCTGATCCCACCAGCTGTGCAAAGTTTAAGGTTGACCAGAACATGTTTTTGCTTATCAGGAAATTGATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

152

Amino Acids

17.3

Weight (kDa)

6.97

Isoelectric Point (pI)

41.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RNA_pol_Rpb8 PF03870 7 - 150 2.1e-43 RNA polymerase Rpb8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 141
AclWI GGATC 2 cut(s) 300, 386
AcuI CTGAAG 1 cut(s) 297
AdeI CACNNNGTG 1 cut(s) 95
AfiI CCNNNNNNNGG 2 cut(s) 226, 317
AflIII ACRYGT 1 cut(s) 429
AgsI TTSAA 2 cut(s) 233, 260
AjnI CCWGG 1 cut(s) 219
AluBI AGCT 3 cut(s) 43, 389, 402
AluI AGCT 3 cut(s) 43, 389, 402
Alw21I GWGCWC 1 cut(s) 208
Alw26I GTCTC 2 cut(s) 186, 246
AlwI GGATC 2 cut(s) 300, 386
ApeKI GCWGC 1 cut(s) 115
AspS9I GGNCC 1 cut(s) 46
AsuC2I CCSGG 1 cut(s) 50
AvaII GGWCC 1 cut(s) 46
BaeI ACNNNNGTAYC 2 cut(s) 15, 48
Bbv12I GWGCWC 1 cut(s) 208
BbvI GCAGC 1 cut(s) 102
BccI CCATC 3 cut(s) 47, 166, 311
BciT130I CCWGG 1 cut(s) 221
BcnI CCSGG 1 cut(s) 50
BcoDI GTCTC 2 cut(s) 186, 246
BfaI CTAG 1 cut(s) 122
BfmI CTRYAG 2 cut(s) 196, 371
BisI GCNGC 1 cut(s) 116
BlsI GCNGC 1 cut(s) 117
Bme1390I CCNGG 2 cut(s) 50, 221
Bme18I GGWCC 1 cut(s) 46
BmgT120I GGNCC 1 cut(s) 46
BmiI GGNNCC 1 cut(s) 48
BmrFI CCNGG 2 cut(s) 50, 221
BpuMI CCSGG 1 cut(s) 50
BsaXI ACNNNNNCTCC 2 cut(s) 195, 225
Bsc4I CCNNNNNNNGG 2 cut(s) 226, 317
BseBI CCWGG 1 cut(s) 221
BseGI GGATG 1 cut(s) 58
BseLI CCNNNNNNNGG 2 cut(s) 226, 317
BseMII CTCAG 1 cut(s) 374
BseXI GCAGC 1 cut(s) 102
BsgI GTGCAG 1 cut(s) 101
BsiHKAI GWGCWC 1 cut(s) 208
BsiSI CCGG 1 cut(s) 50
BslI CCNNNNNNNGG 2 cut(s) 226, 317
BsmAI GTCTC 2 cut(s) 186, 246
Bsp1286I GDGCHC 1 cut(s) 208
Bsp143I GATC 3 cut(s) 292, 302, 391
BspCNI CTCAG 1 cut(s) 375
BspLI GGNNCC 1 cut(s) 48
BspPI GGATC 2 cut(s) 300, 386
BssMI GATC 3 cut(s) 292, 302, 391
BssNAI GTATAC 1 cut(s) 142
Bst1107I GTATAC 1 cut(s) 142
Bst2UI CCWGG 1 cut(s) 221
Bst4CI ACNGT 1 cut(s) 200
BstAPI GCANNNNNTGC 1 cut(s) 277
BstDEI CTNAG 2 cut(s) 5, 383
BstF5I GGATG 1 cut(s) 58
BstKTI GATC 3 cut(s) 295, 305, 394
BstMAI GTCTC 2 cut(s) 186, 246
BstMBI GATC 3 cut(s) 292, 302, 391
BstMWI GCNNNNNNNGC 1 cut(s) 277
BstNI CCWGG 1 cut(s) 221
BstNSI RCATGY 1 cut(s) 433
BstSCI CCNGG 2 cut(s) 48, 219
BstSFI CTRYAG 2 cut(s) 196, 371
BstV1I GCAGC 1 cut(s) 102
BstZ17I GTATAC 1 cut(s) 142
BtsCI GGATG 1 cut(s) 58
BtsIMutI CAGTG 1 cut(s) 205
Cfr13I GGNCC 1 cut(s) 46
CviAII CATG 6 cut(s) 104, 152, 268, 272, 298, 430
CviJI RGCY 6 cut(s) 43, 324, 370, 382, 389, 402
CviKI_1 RGCY 6 cut(s) 43, 324, 370, 382, 389, 402
DdeI CTNAG 2 cut(s) 5, 383
DpnI GATC 3 cut(s) 294, 304, 393
DpnII GATC 3 cut(s) 292, 302, 391
DraIII CACNNNGTG 1 cut(s) 95
Eco47I GGWCC 1 cut(s) 46
Eco57I CTGAAG 1 cut(s) 297
EcoRII CCWGG 1 cut(s) 219
EcoT22I ATGCAT 2 cut(s) 153, 273
FaeI CATG 6 cut(s) 107, 155, 271, 275, 301, 433
FatI CATG 6 cut(s) 103, 151, 267, 271, 297, 429
FblI GTMKAC 1 cut(s) 141
Fnu4HI GCNGC 1 cut(s) 116
FokI GGATG 1 cut(s) 65
Fsp4HI GCNGC 1 cut(s) 116
FspBI CTAG 1 cut(s) 122
GluI GCNGC 1 cut(s) 116
HapII CCGG 1 cut(s) 50
Hin1II CATG 6 cut(s) 107, 155, 271, 275, 301, 433
HincII GTYRAC 1 cut(s) 421
HindII GTYRAC 1 cut(s) 421
HpaII CCGG 1 cut(s) 50
Hpy166II GTNNAC 2 cut(s) 142, 421
Hpy188I TCNGA 2 cut(s) 307, 316
Hpy188III TCNNGA 4 cut(s) 37, 78, 169, 445
Hpy8I GTNNAC 2 cut(s) 142, 421
HpyAV CCTTC 2 cut(s) 151, 321
HpyCH4III ACNGT 1 cut(s) 200
HpyCH4V TGCA 5 cut(s) 118, 151, 248, 271, 407
HpyF10VI GCNNNNNNNGC 1 cut(s) 277
HpyF3I CTNAG 2 cut(s) 5, 383
Hsp92II CATG 6 cut(s) 107, 155, 271, 275, 301, 433
Kzo9I GATC 3 cut(s) 292, 302, 391
LmnI GCTCC 1 cut(s) 203
LpnPI CCDG 9 cut(s) 29, 63, 206, 212, 222, 233, 412, 430, 437
Lsp1109I GCAGC 1 cut(s) 102
MaeI CTAG 1 cut(s) 122
MaeIII GTNAC 1 cut(s) 211
MalI GATC 3 cut(s) 294, 304, 393
MboI GATC 3 cut(s) 292, 302, 391
MhlI GDGCHC 1 cut(s) 208
MluCI AATT 2 cut(s) 81, 449
MnlI CCTC 4 cut(s) 130, 314, 340, 372
Mph1103I ATGCAT 2 cut(s) 153, 273
MseI TTAA 2 cut(s) 192, 414
MslI CAYNNNNRTG 1 cut(s) 123
MspA1I CMGCKG 1 cut(s) 402
MspI CCGG 1 cut(s) 50
MspR9I CCNGG 2 cut(s) 50, 221
MvaI CCWGG 1 cut(s) 221
MwoI GCNNNNNNNGC 1 cut(s) 277
NciI CCSGG 1 cut(s) 50
NdeII GATC 3 cut(s) 292, 302, 391
NlaIII CATG 6 cut(s) 107, 155, 271, 275, 301, 433
NlaIV GGNNCC 1 cut(s) 48
NsiI ATGCAT 2 cut(s) 153, 273
NspI RCATGY 1 cut(s) 433
PciI ACATGT 1 cut(s) 429
PkrI GCNGC 1 cut(s) 117
PscI ACATGT 1 cut(s) 429
Psp6I CCWGG 1 cut(s) 219
PspGI CCWGG 1 cut(s) 219
PspN4I GGNNCC 1 cut(s) 48
PspPI GGNCC 1 cut(s) 46
PvuII CAGCTG 1 cut(s) 402
RseI CAYNNNNRTG 1 cut(s) 123
SaqAI TTAA 2 cut(s) 192, 414
SatI GCNGC 1 cut(s) 116
Sau3AI GATC 3 cut(s) 292, 302, 391
Sau96I GGNCC 1 cut(s) 46
ScrFI CCNGG 2 cut(s) 50, 221
SduI GDGCHC 1 cut(s) 208
SfcI CTRYAG 2 cut(s) 196, 371
SinI GGWCC 1 cut(s) 46
SmiMI CAYNNNNRTG 1 cut(s) 123
Sse9I AATT 2 cut(s) 81, 449
SspMI CTAG 1 cut(s) 122
StyD4I CCNGG 2 cut(s) 48, 219
TaaI ACNGT 1 cut(s) 200
TaqI TCGA 2 cut(s) 36, 79
TasI AATT 2 cut(s) 81, 449
Tru1I TTAA 2 cut(s) 192, 414
Tru9I TTAA 2 cut(s) 192, 414
TscAI CASTG 1 cut(s) 205
TseI GCWGC 1 cut(s) 115
TspGWI ACGGA 1 cut(s) 106
TspRI CASTG 1 cut(s) 205
VpaK11BI GGWCC 1 cut(s) 46
XceI RCATGY 1 cut(s) 433
XmiI GTMKAC 1 cut(s) 141
XspI CTAG 1 cut(s) 122
Zsp2I ATGCAT 2 cut(s) 153, 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.