Rmu_sc0021422.1_g000001

Plant protein of unknown function (DUF936)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021422.1
Physical Location & Seq
Forward (+)
212 .. 514
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021422.1_g000001.1.cds

Sequence Viewer

Length: 303 bp
atggtgtcacccactcccggaatcctcctccgactcctccagtccatgaactccgccactaaagtcaccggcgaccaccgatcttccctgctccaagtcatcggcatagtccccgccctcgccgactccgacgacctctggcccaaccaaggcttctatgtctggctctccgactccacctatgtctgcctctccgagaaagacaccgatctcatcctcgccaaccgcctccagctcgaccagttcgtctacgtcgactttttctttgatcactttctcttcggtcaaacgggtcgggtatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.27

Weight (kDa)

4.52

Isoelectric Point (pI)

45.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 245
AccI GTMKAC 2 cut(s) 249, 255
AciI CCGC 3 cut(s) 54, 114, 226
AfiI CCNNNNNNNGG 2 cut(s) 17, 149
AjuI GAANNNNNNNTTGG 2 cut(s) 137, 169
AluBI AGCT 1 cut(s) 235
AluI AGCT 1 cut(s) 235
AoxI GGCC 1 cut(s) 140
ArsI GACNNNNNNTTYG 2 cut(s) 248, 280
AspS9I GGNCC 1 cut(s) 141
AsuC2I CCSGG 1 cut(s) 18
AsuHPI GGTGA 1 cut(s) 58
BclI TGATCA 1 cut(s) 268
BcnI CCSGG 1 cut(s) 18
Bme1390I CCNGG 1 cut(s) 18
BmgT120I GGNCC 1 cut(s) 141
BmrFI CCNGG 1 cut(s) 18
BpmI CTGGAG 2 cut(s) 23, 215
BpuMI CCSGG 1 cut(s) 18
BsaJI CCNNGG 1 cut(s) 148
Bsc4I CCNNNNNNNGG 2 cut(s) 17, 149
Bse118I RCCGGY 1 cut(s) 68
Bse1I ACTGG 2 cut(s) 40, 241
BseDI CCNNGG 1 cut(s) 148
BseGI GGATG 1 cut(s) 213
BseLI CCNNNNNNNGG 2 cut(s) 17, 149
BseNI ACTGG 2 cut(s) 40, 241
BseRI GAGGAG 2 cut(s) 17, 26
BshFI GGCC 1 cut(s) 142
BsiSI CCGG 2 cut(s) 18, 69
BslFI GGGAC 1 cut(s) 95
BslI CCNNNNNNNGG 2 cut(s) 17, 149
BsmFI GGGAC 1 cut(s) 95
BsnI GGCC 1 cut(s) 142
Bsp143I GATC 3 cut(s) 80, 208, 268
BspACI CCGC 3 cut(s) 54, 114, 226
BspANI GGCC 1 cut(s) 142
BsrFI RCCGGY 1 cut(s) 68
BsrI ACTGG 2 cut(s) 40, 241
BssAI RCCGGY 1 cut(s) 68
BssECI CCNNGG 1 cut(s) 148
BssMI GATC 3 cut(s) 80, 208, 268
BssT1I CCWWGG 1 cut(s) 148
Bst6I CTCTTC 1 cut(s) 284
BstF5I GGATG 1 cut(s) 213
BstKTI GATC 3 cut(s) 83, 211, 271
BstMBI GATC 3 cut(s) 80, 208, 268
BstSCI CCNGG 1 cut(s) 16
BsuRI GGCC 1 cut(s) 142
BtsCI GGATG 1 cut(s) 213
Cfr10I RCCGGY 1 cut(s) 68
Cfr13I GGNCC 1 cut(s) 141
CviAII CATG 1 cut(s) 46
CviJI RGCY 4 cut(s) 142, 153, 166, 235
CviKI_1 RGCY 4 cut(s) 142, 153, 166, 235
DpnI GATC 3 cut(s) 82, 210, 270
DpnII GATC 3 cut(s) 80, 208, 268
DrdI GACNNNNNNGTC 1 cut(s) 245
DseDI GACNNNNNNGTC 1 cut(s) 245
Eam1104I CTCTTC 1 cut(s) 284
EarI CTCTTC 1 cut(s) 284
EciI GGCGGA 1 cut(s) 43
Eco130I CCWWGG 1 cut(s) 148
EcoT14I CCWWGG 1 cut(s) 148
ErhI CCWWGG 1 cut(s) 148
FaeI CATG 1 cut(s) 49
FaiI YATR 5 cut(s) 47, 107, 159, 183, 301
FaqI GGGAC 1 cut(s) 95
FatI CATG 1 cut(s) 45
FauI CCCGC 1 cut(s) 121
FbaI TGATCA 1 cut(s) 268
FblI GTMKAC 2 cut(s) 249, 255
FokI GGATG 1 cut(s) 200
GsuI CTGGAG 2 cut(s) 23, 215
HaeIII GGCC 1 cut(s) 142
HapII CCGG 2 cut(s) 18, 69
Hin1II CATG 1 cut(s) 49
HincII GTYRAC 1 cut(s) 256
HindII GTYRAC 1 cut(s) 256
HinfI GANTC 4 cut(s) 21, 33, 125, 173
HpaII CCGG 2 cut(s) 18, 69
HphI GGTGA 1 cut(s) 58
Hpy166II GTNNAC 2 cut(s) 250, 256
Hpy188I TCNGA 4 cut(s) 32, 130, 172, 196
Hpy8I GTNNAC 2 cut(s) 250, 256
Hpy99I CGWCG 2 cut(s) 134, 257
HpyCH4IV ACGT 1 cut(s) 252
HpySE526I ACGT 1 cut(s) 252
Hsp92II CATG 1 cut(s) 49
Ksp22I TGATCA 1 cut(s) 268
Kzo9I GATC 3 cut(s) 80, 208, 268
LmnI GCTCC 1 cut(s) 96
LpnPI CCDG 8 cut(s) 31, 53, 82, 101, 124, 148, 245, 254
MaeII ACGT 1 cut(s) 252
MaeIII GTNAC 2 cut(s) 6, 64
MalI GATC 3 cut(s) 82, 210, 270
MboI GATC 3 cut(s) 80, 208, 268
MboII GAAGA 2 cut(s) 75, 271
MlyI GAGTC 3 cut(s) 27, 119, 167
MmeI TCCRAC 3 cut(s) 55, 153, 195
MnlI CCTC 8 cut(s) 35, 38, 47, 128, 146, 200, 227, 239
MspI CCGG 2 cut(s) 18, 69
MspR9I CCNGG 1 cut(s) 18
NciI CCSGG 1 cut(s) 18
NdeII GATC 3 cut(s) 80, 208, 268
NlaIII CATG 1 cut(s) 49
NmuCI GTSAC 2 cut(s) 6, 64
PcsI WCGNNNNNNNCGW 3 cut(s) 126, 243, 252
PfeI GAWTC 1 cut(s) 21
PfoI TCCNGGA 1 cut(s) 16
PleI GAGTC 3 cut(s) 27, 119, 167
PpsI GAGTC 3 cut(s) 27, 119, 167
PspPI GGNCC 1 cut(s) 141
SalI GTCGAC 1 cut(s) 254
Sau3AI GATC 3 cut(s) 80, 208, 268
Sau96I GGNCC 1 cut(s) 141
SchI GAGTC 3 cut(s) 27, 119, 167
ScrFI CCNGG 1 cut(s) 18
SetI ASST 4 cut(s) 138, 182, 237, 255
SgrAI CRCCGGYG 1 cut(s) 68
SsiI CCGC 3 cut(s) 54, 114, 226
StyD4I CCNGG 1 cut(s) 16
StyI CCWWGG 1 cut(s) 148
TaiI ACGT 1 cut(s) 255
TaqI TCGA 2 cut(s) 237, 255
TaqII GACCGA 1 cut(s) 272
TfiI GAWTC 1 cut(s) 21
TseFI GTSAC 2 cut(s) 6, 64
Tsp45I GTSAC 2 cut(s) 6, 64
TspDTI ATGAA 1 cut(s) 62
XmiI GTMKAC 2 cut(s) 249, 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.