Rroxscaffold_2G00120120

DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0008445
Physical Location & Seq
Forward (+)
52203763 .. 52205919
2157 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00120120.1

Sequence Viewer

Length: 366 bp
ATGTCGTCCATGTCAGAGTCTCGTGCTTTCCTGTTCTGCAACAGCTGTGGGTATATGCTATCTTTGACGACAACTCCTTATGCTAAACCTGGCCGATGCCCCTATTGCAACCATCCGCGACCTATAGAAGGGCTCTCCAAATGTAAATATTCATACACAGTCAGTAAAGAGGATATTCAAAGGGAGCTAGGCAAATCAACAATTAAGGAGGAAAAGACTGAATTGGCAAAGACGGACATGAAAAAATGTGAAAAGTGTGGTCACAATGAGCATACATATTTTTCTAGACAGATGAGATCAGCTGATGAAGGGGCAACTACTTTCTACACTTGCACCAAGTGCAATAATAGTTTCAGTGAAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00230 ko00240 ko01100 ko03020 map00230 map00240 map01100 map03020
Pfam Domains
Protein Families
TFIIS_C

Protein Analysis

121

Amino Acids

13.81

Weight (kDa)

8.55

Isoelectric Point (pI)

53.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Zn_ribbon_TFIIS PF01096 81 - 118 3e-17 Transcription factor S-II (TFIIS)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 118
AciI CCGC 1 cut(s) 116
AcoI YGGCCR 1 cut(s) 91
AdeI CACNNNGTG 1 cut(s) 339
AfiI CCNNNNNNNGG 1 cut(s) 128
AgsI TTSAA 1 cut(s) 179
AjnI CCWGG 1 cut(s) 88
AluBI AGCT 3 cut(s) 45, 187, 302
AluI AGCT 3 cut(s) 45, 187, 302
Alw26I GTCTC 1 cut(s) 24
AoxI GGCC 1 cut(s) 91
BanII GRGCYC 1 cut(s) 135
BauI CACGAG 1 cut(s) 21
BccI CCATC 1 cut(s) 120
BciT130I CCWGG 1 cut(s) 90
BcoDI GTCTC 1 cut(s) 24
BfaI CTAG 2 cut(s) 188, 285
BfmI CTRYAG 1 cut(s) 123
Bme1390I CCNGG 1 cut(s) 90
BmrFI CCNGG 1 cut(s) 90
BmsI GCATC 1 cut(s) 86
BsaXI ACNNNNNCTCC 2 cut(s) 58, 88
Bsc4I CCNNNNNNNGG 1 cut(s) 128
BseBI CCWGG 1 cut(s) 90
BseGI GGATG 1 cut(s) 112
BseLI CCNNNNNNNGG 1 cut(s) 128
Bsh1236I CGCG 1 cut(s) 118
BshFI GGCC 1 cut(s) 93
BslI CCNNNNNNNGG 1 cut(s) 128
BsmAI GTCTC 1 cut(s) 24
BsnI GGCC 1 cut(s) 93
Bsp1286I GDGCHC 1 cut(s) 135
Bsp143I GATC 1 cut(s) 296
BspACI CCGC 1 cut(s) 116
BspANI GGCC 1 cut(s) 93
BspFNI CGCG 1 cut(s) 118
BssMI GATC 1 cut(s) 296
BssSI CACGAG 1 cut(s) 21
Bst2BI CACGAG 1 cut(s) 21
Bst2UI CCWGG 1 cut(s) 90
Bst4CI ACNGT 1 cut(s) 160
BstAPI GCANNNNNTGC 1 cut(s) 339
BstENI CCTNNNNNAGG 1 cut(s) 126
BstF5I GGATG 1 cut(s) 112
BstFNI CGCG 1 cut(s) 118
BstKTI GATC 1 cut(s) 299
BstMAI GTCTC 1 cut(s) 24
BstMBI GATC 1 cut(s) 296
BstMWI GCNNNNNNNGC 2 cut(s) 105, 339
BstNI CCWGG 1 cut(s) 90
BstSCI CCNGG 1 cut(s) 88
BstSFI CTRYAG 1 cut(s) 123
BstUI CGCG 1 cut(s) 118
BsuRI GGCC 1 cut(s) 93
BtsCI GGATG 1 cut(s) 112
BtsIMutI CAGTG 1 cut(s) 361
CspCI CAANNNNNGTGG 2 cut(s) 28, 63
CviAII CATG 2 cut(s) 10, 238
CviJI RGCY 5 cut(s) 45, 93, 133, 187, 302
CviKI_1 RGCY 5 cut(s) 45, 93, 133, 187, 302
DpnI GATC 1 cut(s) 298
DpnII GATC 1 cut(s) 296
DraIII CACNNNGTG 1 cut(s) 339
EaeI YGGCCR 1 cut(s) 91
Eco24I GRGCYC 1 cut(s) 135
EcoNI CCTNNNNNAGG 1 cut(s) 126
EcoRII CCWGG 1 cut(s) 88
EcoT38I GRGCYC 1 cut(s) 135
FaeI CATG 2 cut(s) 13, 241
FaiI YATR 9 cut(s) 11, 54, 56, 81, 125, 154, 239, 273, 277
FatI CATG 2 cut(s) 9, 237
FokI GGATG 1 cut(s) 99
FriOI GRGCYC 1 cut(s) 135
FspBI CTAG 2 cut(s) 188, 285
HaeIII GGCC 1 cut(s) 93
Hin1II CATG 2 cut(s) 13, 241
HinfI GANTC 1 cut(s) 17
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 1 cut(s) 285
HpyAV CCTTC 2 cut(s) 122, 302
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4V TGCA 4 cut(s) 39, 108, 333, 342
HpyF10VI GCNNNNNNNGC 2 cut(s) 105, 339
Hsp92II CATG 2 cut(s) 13, 241
Kzo9I GATC 1 cut(s) 296
LmnI GCTCC 1 cut(s) 184
LpnPI CCDG 3 cut(s) 44, 75, 102
LweI GCATC 1 cut(s) 86
MaeI CTAG 2 cut(s) 188, 285
MaeIII GTNAC 1 cut(s) 260
MalI GATC 1 cut(s) 298
MboI GATC 1 cut(s) 296
MhlI GDGCHC 1 cut(s) 135
MluCI AATT 3 cut(s) 201, 221, 361
MlyI GAGTC 1 cut(s) 26
MnlI CCTC 2 cut(s) 163, 202
MseI TTAA 2 cut(s) 204, 364
MspA1I CMGCKG 2 cut(s) 45, 302
MspR9I CCNGG 1 cut(s) 90
MvaI CCWGG 1 cut(s) 90
MvnI CGCG 1 cut(s) 118
MwoI GCNNNNNNNGC 2 cut(s) 105, 339
NdeII GATC 1 cut(s) 296
NlaIII CATG 2 cut(s) 13, 241
NmuCI GTSAC 1 cut(s) 260
PleI GAGTC 1 cut(s) 25
PpsI GAGTC 1 cut(s) 25
Psp6I CCWGG 1 cut(s) 88
PspGI CCWGG 1 cut(s) 88
PvuII CAGCTG 2 cut(s) 45, 302
SaqAI TTAA 2 cut(s) 204, 364
Sau3AI GATC 1 cut(s) 296
SchI GAGTC 1 cut(s) 26
ScrFI CCNGG 1 cut(s) 90
SduI GDGCHC 1 cut(s) 135
SetI ASST 5 cut(s) 47, 91, 124, 189, 304
SfaNI GCATC 1 cut(s) 86
SfcI CTRYAG 1 cut(s) 123
Sse9I AATT 3 cut(s) 201, 221, 361
SsiI CCGC 1 cut(s) 116
SspI AATATT 1 cut(s) 149
SspMI CTAG 2 cut(s) 188, 285
StyD4I CCNGG 1 cut(s) 88
TaaI ACNGT 1 cut(s) 160
TasI AATT 3 cut(s) 201, 221, 361
Tru1I TTAA 2 cut(s) 204, 364
Tru9I TTAA 2 cut(s) 204, 364
TscAI CASTG 1 cut(s) 361
TseFI GTSAC 1 cut(s) 260
Tsp45I GTSAC 1 cut(s) 260
TspDTI ATGAA 3 cut(s) 141, 254, 321
TspGWI ACGGA 1 cut(s) 248
TspRI CASTG 1 cut(s) 361
XagI CCTNNNNNAGG 1 cut(s) 126
XbaI TCTAGA 1 cut(s) 284
XspI CTAG 2 cut(s) 188, 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.