AT2G45243

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Forward (+)
18660696 .. 18661296
601 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G45243.1

Sequence Viewer

Length: 87 bp
ATGATCTCAAATCTCTCTTTGTTTCCCTCGCTTCCAAGTCTCACAGCAATGACCAATACGTCTCGTACCCTGTTTTCCAGGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

28

Amino Acids

3.13

Weight (kDa)

12.0

Isoelectric Point (pI)

41.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 58
AfaI GTAC 1 cut(s) 67
AjnI CCWGG 1 cut(s) 77
Alw26I GTCTC 2 cut(s) 44, 66
BciT130I CCWGG 1 cut(s) 79
BcoDI GTCTC 2 cut(s) 44, 66
Bme1390I CCNGG 1 cut(s) 79
BmrFI CCNGG 1 cut(s) 79
Bse3DI GCAATG 1 cut(s) 54
BseBI CCWGG 1 cut(s) 79
BseMI GCAATG 1 cut(s) 54
BsmAI GTCTC 2 cut(s) 44, 66
BsmBI CGTCTC 1 cut(s) 66
Bsp143I GATC 1 cut(s) 3
BsrDI GCAATG 1 cut(s) 54
BssMI GATC 1 cut(s) 3
Bst2UI CCWGG 1 cut(s) 79
BstKTI GATC 1 cut(s) 6
BstMAI GTCTC 2 cut(s) 44, 66
BstMBI GATC 1 cut(s) 3
BstNI CCWGG 1 cut(s) 79
BstSCI CCNGG 1 cut(s) 77
Csp6I GTAC 1 cut(s) 66
CviQI GTAC 1 cut(s) 66
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
DrdI GACNNNNNNGTC 1 cut(s) 58
DseDI GACNNNNNNGTC 1 cut(s) 58
EcoRII CCWGG 1 cut(s) 77
Esp3I CGTCTC 1 cut(s) 66
FspEI CC 7 cut(s) 39, 40, 48, 64, 67, 82, 83
HpyCH4IV ACGT 1 cut(s) 59
HpySE526I ACGT 1 cut(s) 59
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 2 cut(s) 64, 83
MaeII ACGT 1 cut(s) 59
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MnlI CCTC 1 cut(s) 37
MslI CAYNNNNRTG 1 cut(s) 47
MspR9I CCNGG 1 cut(s) 79
MvaI CCWGG 1 cut(s) 79
NdeII GATC 1 cut(s) 3
Psp6I CCWGG 1 cut(s) 77
PspGI CCWGG 1 cut(s) 77
RsaI GTAC 1 cut(s) 67
RsaNI GTAC 1 cut(s) 66
RseI CAYNNNNRTG 1 cut(s) 47
Sau3AI GATC 1 cut(s) 3
ScrFI CCNGG 1 cut(s) 79
SetI ASST 2 cut(s) 62, 83
SgeI CNNG 4 cut(s) 40, 48, 75, 82
SmiMI CAYNNNNRTG 1 cut(s) 47
StyD4I CCNGG 1 cut(s) 77
TaiI ACGT 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.