AT3G24890

SNAP receptor activity

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Forward (+)
9097391 .. 9099073
1683 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G24890.4

Sequence Viewer

Length: 225 bp
ATGGTGGTGGATAGGAATGGCTACAACTACTTAACCCAACAGCTTGAACAAAGAGTTTTGGTACTTTTGGCTCATCCCGAGGAGATTAGCAAACTTGCCAAGGTTAAGGCTCTAGTGACCAAAATGAAAGGTGTTATGATGGAGAACATTGAGAAGGCTCTTGACCGCAGTGAGAAAATTAAAATTCTAGTGGACCTTCGTTCAAAGGTCAAGAAGATATCATAA

Protein Analysis

74

Amino Acids

8.52

Weight (kDa)

9.79

Isoelectric Point (pI)

38.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Synaptobrevin PF00957 31 - 65 8.4e-07 Synaptobrevin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 166
AcsI RAATTY 1 cut(s) 183
AfaI GTAC 1 cut(s) 63
AgsI TTSAA 2 cut(s) 47, 204
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
Ama87I CYCGRG 1 cut(s) 77
ApoI RAATTY 1 cut(s) 183
AspS9I GGNCC 1 cut(s) 193
AvaI CYCGRG 1 cut(s) 77
AvaII GGWCC 1 cut(s) 193
BccI CCATC 1 cut(s) 133
BfaI CTAG 2 cut(s) 113, 188
Bme18I GGWCC 1 cut(s) 193
BmeT110I CYCGRG 1 cut(s) 77
BmgT120I GGNCC 1 cut(s) 193
BsaJI CCNNGG 2 cut(s) 78, 99
BseDI CCNNGG 2 cut(s) 78, 99
BseGI GGATG 1 cut(s) 73
BseRI GAGGAG 1 cut(s) 95
BsiHKCI CYCGRG 1 cut(s) 77
BsoBI CYCGRG 1 cut(s) 77
BspACI CCGC 1 cut(s) 166
BssECI CCNNGG 2 cut(s) 78, 99
BssT1I CCWWGG 1 cut(s) 99
BstF5I GGATG 1 cut(s) 73
BtsCI GGATG 1 cut(s) 73
BtsI GCAGTG 1 cut(s) 175
BtsIMutI CAGTG 1 cut(s) 175
Cfr13I GGNCC 1 cut(s) 193
Csp6I GTAC 1 cut(s) 62
CviJI RGCY 5 cut(s) 21, 43, 71, 110, 158
CviKI_1 RGCY 5 cut(s) 21, 43, 71, 110, 158
CviQI GTAC 1 cut(s) 62
Eco130I CCWWGG 1 cut(s) 99
Eco32I GATATC 1 cut(s) 219
Eco47I GGWCC 1 cut(s) 193
Eco88I CYCGRG 1 cut(s) 77
EcoRV GATATC 1 cut(s) 219
EcoT14I CCWWGG 1 cut(s) 99
ErhI CCWWGG 1 cut(s) 99
FaiI YATR 2 cut(s) 137, 223
FokI GGATG 1 cut(s) 60
FspBI CTAG 2 cut(s) 113, 188
Hpy166II GTNNAC 1 cut(s) 193
Hpy188III TCNNGA 3 cut(s) 77, 161, 211
Hpy8I GTNNAC 1 cut(s) 193
HpyAV CCTTC 2 cut(s) 148, 206
MaeI CTAG 2 cut(s) 113, 188
MaeIII GTNAC 1 cut(s) 115
MluCI AATT 2 cut(s) 177, 183
MnlI CCTC 1 cut(s) 73
MseI TTAA 3 cut(s) 32, 105, 180
NmuCI GTSAC 1 cut(s) 115
PspPI GGNCC 1 cut(s) 193
RsaI GTAC 1 cut(s) 63
RsaNI GTAC 1 cut(s) 62
SaqAI TTAA 3 cut(s) 32, 105, 180
Sau96I GGNCC 1 cut(s) 193
SetI ASST 5 cut(s) 45, 105, 133, 198, 210
SgeI CNNG 8 cut(s) 56, 89, 91, 107, 112, 125, 173, 200
SinI GGWCC 1 cut(s) 193
Sse9I AATT 2 cut(s) 177, 183
SsiI CCGC 1 cut(s) 166
SspMI CTAG 2 cut(s) 113, 188
StyI CCWWGG 1 cut(s) 99
TasI AATT 2 cut(s) 177, 183
Tru1I TTAA 3 cut(s) 32, 105, 180
Tru9I TTAA 3 cut(s) 32, 105, 180
TscAI CASTG 1 cut(s) 175
TseFI GTSAC 1 cut(s) 115
Tsp45I GTSAC 1 cut(s) 115
TspDTI ATGAA 1 cut(s) 140
TspRI CASTG 1 cut(s) 175
VpaK11BI GGWCC 1 cut(s) 193
XapI RAATTY 1 cut(s) 183
XspI CTAG 2 cut(s) 113, 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.