Rh6AG225500

Regulated-SNARE-like domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
40645552 .. 40661200
15649 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG225500.1

Sequence Viewer

Length: 285 bp
ATGAAGTACTGTGTGGATCATCTTGAAGAGATAAACAAGCTTTCAAAAGTGAAGGTTCAAGTTACTGAGGTCAAGGGTGTTATGATGGAAAATATGGAGAAGGTTCTTGATCGTGGTGAGAAGATTGAGCTATTGGTGGATAAGACTGATAACCCAGTGCTGGTTCTTGCAAAGCTTAGTCGAGGATCGCCTGACAAGGATAGAAGGAACCCAATCATAGTCAACTGTGAATATCAAATTGTCAAGGATATTTTTTTGGAAGCCAAACACTATCGTGGTGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.84

Weight (kDa)

7.75

Isoelectric Point (pI)

21.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Synaptobrevin PF00957 13 - 51 1.9e-12 Synaptobrevin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 24, 193
AfaI GTAC 1 cut(s) 8
AfiI CCNNNNNNNGG 1 cut(s) 160
AgsI TTSAA 3 cut(s) 26, 45, 59
AleI CACNNNNGTG 1 cut(s) 273
AluBI AGCT 3 cut(s) 40, 130, 175
AluI AGCT 3 cut(s) 40, 130, 175
AlwI GGATC 2 cut(s) 24, 193
AsuHPI GGTGA 1 cut(s) 128
BccI CCATC 1 cut(s) 79
BmcAI AGTACT 1 cut(s) 8
BmiI GGNNCC 1 cut(s) 209
BmrI ACTGGG 1 cut(s) 149
BmuI ACTGGG 1 cut(s) 149
Bsc4I CCNNNNNNNGG 1 cut(s) 160
Bse1I ACTGG 1 cut(s) 155
BseLI CCNNNNNNNGG 1 cut(s) 160
BseMII CTCAG 1 cut(s) 57
BseNI ACTGG 1 cut(s) 155
BslI CCNNNNNNNGG 1 cut(s) 160
Bsp143I GATC 3 cut(s) 16, 109, 185
BspCNI CTCAG 1 cut(s) 58
BspLI GGNNCC 1 cut(s) 209
BspPI GGATC 2 cut(s) 24, 193
BsrI ACTGG 1 cut(s) 155
BssMI GATC 3 cut(s) 16, 109, 185
Bst4CI ACNGT 2 cut(s) 11, 227
Bst6I CTCTTC 1 cut(s) 21
BstDEI CTNAG 2 cut(s) 66, 176
BstKTI GATC 3 cut(s) 19, 112, 188
BstMBI GATC 3 cut(s) 16, 109, 185
BtsIMutI CAGTG 1 cut(s) 162
Csp6I GTAC 1 cut(s) 7
CviJI RGCY 4 cut(s) 40, 130, 175, 263
CviKI_1 RGCY 4 cut(s) 40, 130, 175, 263
CviQI GTAC 1 cut(s) 7
DdeI CTNAG 2 cut(s) 66, 176
DpnI GATC 3 cut(s) 18, 111, 187
DpnII GATC 3 cut(s) 16, 109, 185
Eam1104I CTCTTC 1 cut(s) 21
EarI CTCTTC 1 cut(s) 21
FaiI YATR 3 cut(s) 83, 95, 218
HincII GTYRAC 1 cut(s) 223
HindII GTYRAC 1 cut(s) 223
HindIII AAGCTT 2 cut(s) 38, 173
HphI GGTGA 1 cut(s) 128
Hpy166II GTNNAC 1 cut(s) 223
Hpy188III TCNNGA 2 cut(s) 23, 107
Hpy8I GTNNAC 1 cut(s) 223
HpyAV CCTTC 3 cut(s) 46, 94, 198
HpyCH4III ACNGT 2 cut(s) 11, 227
HpyCH4V TGCA 1 cut(s) 170
HpyF3I CTNAG 2 cut(s) 66, 176
Kzo9I GATC 3 cut(s) 16, 109, 185
LpnPI CCDG 3 cut(s) 146, 168, 204
MaeIII GTNAC 1 cut(s) 61
MalI GATC 3 cut(s) 18, 111, 187
MboI GATC 3 cut(s) 16, 109, 185
MboII GAAGA 2 cut(s) 38, 133
MluCI AATT 1 cut(s) 237
MnlI CCTC 2 cut(s) 61, 176
MseI TTAA 1 cut(s) 283
MslI CAYNNNNRTG 1 cut(s) 273
NdeII GATC 3 cut(s) 16, 109, 185
NlaIV GGNNCC 1 cut(s) 209
OliI CACNNNNGTG 1 cut(s) 273
PspN4I GGNNCC 1 cut(s) 209
RsaI GTAC 1 cut(s) 8
RsaNI GTAC 1 cut(s) 7
RseI CAYNNNNRTG 1 cut(s) 273
SaqAI TTAA 1 cut(s) 283
Sau3AI GATC 3 cut(s) 16, 109, 185
ScaI AGTACT 1 cut(s) 8
SetI ASST 6 cut(s) 42, 57, 72, 105, 132, 177
SmiMI CAYNNNNRTG 1 cut(s) 273
Sse9I AATT 1 cut(s) 237
TaaI ACNGT 2 cut(s) 11, 227
TaqI TCGA 1 cut(s) 181
TasI AATT 1 cut(s) 237
TatI WGTACW 1 cut(s) 6
Tru1I TTAA 1 cut(s) 283
Tru9I TTAA 1 cut(s) 283
TscAI CASTG 1 cut(s) 162
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 162
ZrmI AGTACT 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.