Rh6DG223700

Regulated-SNARE-like domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0011845
Physical Location & Seq
Forward (+)
40132602 .. 40143249
10648 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG223700.1

Sequence Viewer

Length: 258 bp
ATGGACGCAGAAGAGCTAGGGCTAGCGATGCTTTTCTTCGACTTTAAGCGGTCCCACGGTCACAACTCACATGAGGGACCAAAGCTAACAGAGCACATGAAGTACTGTGTGGATCATCTTGAAGAGATAAACAAGCTTGCAAAAGTGAAGGCTCACGTTACTGAGGTCAAGGGTGTTATGATGGAAAATAGTGAGAAGGTTCTTGATCGTGGTGAGAAGATTGAGCAGTTGGTGGATAAGACTGATAACCCAGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04130 map04130
Pfam Domains
Protein Families
Longin Synaptobrevin

Protein Analysis

85

Amino Acids

9.7

Weight (kDa)

5.62

Isoelectric Point (pI)

27.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Synaptobrevin PF00957 45 - 83 2.2e-11 Synaptobrevin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 49
AclWI GGATC 1 cut(s) 120
AfaI GTAC 1 cut(s) 104
AgsI TTSAA 1 cut(s) 122
AjnI CCWGG 1 cut(s) 250
AluBI AGCT 3 cut(s) 16, 85, 136
AluI AGCT 3 cut(s) 16, 85, 136
Alw21I GWGCWC 1 cut(s) 96
AlwI GGATC 1 cut(s) 120
AspS9I GGNCC 2 cut(s) 51, 77
AsuHPI GGTGA 1 cut(s) 224
AsuNHI GCTAGC 1 cut(s) 22
AvaII GGWCC 2 cut(s) 51, 77
Bbv12I GWGCWC 1 cut(s) 96
BccI CCATC 1 cut(s) 175
BciT130I CCWGG 1 cut(s) 252
BfaI CTAG 2 cut(s) 17, 23
BmcAI AGTACT 1 cut(s) 104
Bme1390I CCNGG 1 cut(s) 252
Bme18I GGWCC 2 cut(s) 51, 77
BmgT120I GGNCC 2 cut(s) 51, 77
BmiI GGNNCC 2 cut(s) 53, 78
BmrFI CCNGG 1 cut(s) 252
BmsI GCATC 1 cut(s) 18
BmtI GCTAGC 1 cut(s) 26
BsaJI CCNNGG 2 cut(s) 55, 250
BseBI CCWGG 1 cut(s) 252
BseDI CCNNGG 2 cut(s) 55, 250
BseMII CTCAG 1 cut(s) 153
BsiHKAI GWGCWC 1 cut(s) 96
BslFI GGGAC 2 cut(s) 37, 90
BsmFI GGGAC 2 cut(s) 37, 90
Bsp1286I GDGCHC 1 cut(s) 96
Bsp143I GATC 2 cut(s) 112, 205
BspACI CCGC 1 cut(s) 49
BspCNI CTCAG 1 cut(s) 154
BspLI GGNNCC 2 cut(s) 53, 78
BspOI GCTAGC 1 cut(s) 26
BspPI GGATC 1 cut(s) 120
BspQI GCTCTTC 1 cut(s) 6
BssECI CCNNGG 2 cut(s) 55, 250
BssMI GATC 2 cut(s) 112, 205
Bst2UI CCWGG 1 cut(s) 252
Bst4CI ACNGT 2 cut(s) 59, 107
Bst6I CTCTTC 2 cut(s) 6, 117
BstC8I GCNNGC 2 cut(s) 24, 138
BstDEI CTNAG 1 cut(s) 162
BstDSI CCRYGG 1 cut(s) 55
BstKTI GATC 2 cut(s) 115, 208
BstMBI GATC 2 cut(s) 112, 205
BstMWI GCNNNNNNNGC 2 cut(s) 28, 91
BstNI CCWGG 1 cut(s) 252
BstSCI CCNGG 1 cut(s) 250
BtgI CCRYGG 1 cut(s) 55
BtgZI GCGATG 1 cut(s) 41
Cac8I GCNNGC 2 cut(s) 24, 138
Cfr13I GGNCC 2 cut(s) 51, 77
CseI GACGC 1 cut(s) 14
Csp6I GTAC 1 cut(s) 103
CviAII CATG 2 cut(s) 71, 97
CviJI RGCY 5 cut(s) 16, 22, 85, 136, 152
CviKI_1 RGCY 5 cut(s) 16, 22, 85, 136, 152
CviQI GTAC 1 cut(s) 103
DdeI CTNAG 1 cut(s) 162
DpnI GATC 2 cut(s) 114, 207
DpnII GATC 2 cut(s) 112, 205
Eam1104I CTCTTC 2 cut(s) 6, 117
EarI CTCTTC 2 cut(s) 6, 117
Eco47I GGWCC 2 cut(s) 51, 77
EcoRII CCWGG 1 cut(s) 250
FaeI CATG 2 cut(s) 74, 100
FaiI YATR 3 cut(s) 72, 98, 179
FaqI GGGAC 2 cut(s) 37, 90
FatI CATG 2 cut(s) 70, 96
FspBI CTAG 2 cut(s) 17, 23
HgaI GACGC 1 cut(s) 14
Hin1II CATG 2 cut(s) 74, 100
HindIII AAGCTT 1 cut(s) 134
HphI GGTGA 1 cut(s) 224
Hpy188III TCNNGA 2 cut(s) 119, 203
HpyAV CCTTC 2 cut(s) 142, 190
HpyCH4III ACNGT 2 cut(s) 59, 107
HpyCH4IV ACGT 1 cut(s) 156
HpyCH4V TGCA 1 cut(s) 140
HpyF10VI GCNNNNNNNGC 2 cut(s) 28, 91
HpyF3I CTNAG 1 cut(s) 162
HpySE526I ACGT 1 cut(s) 156
Hsp92II CATG 2 cut(s) 74, 100
Kzo9I GATC 2 cut(s) 112, 205
LguI GCTCTTC 1 cut(s) 6
LpnPI CCDG 1 cut(s) 237
LweI GCATC 1 cut(s) 18
MaeI CTAG 2 cut(s) 17, 23
MaeII ACGT 1 cut(s) 156
MaeIII GTNAC 2 cut(s) 59, 157
MalI GATC 2 cut(s) 114, 207
MboI GATC 2 cut(s) 112, 205
MboII GAAGA 4 cut(s) 23, 28, 134, 229
MhlI GDGCHC 1 cut(s) 96
MnlI CCTC 2 cut(s) 67, 157
MseI TTAA 1 cut(s) 45
MspR9I CCNGG 1 cut(s) 252
MvaI CCWGG 1 cut(s) 252
MwoI GCNNNNNNNGC 2 cut(s) 28, 91
NdeII GATC 2 cut(s) 112, 205
NheI GCTAGC 1 cut(s) 22
NlaIII CATG 2 cut(s) 74, 100
NlaIV GGNNCC 2 cut(s) 53, 78
NmuCI GTSAC 1 cut(s) 59
PciSI GCTCTTC 1 cut(s) 6
Psp6I CCWGG 1 cut(s) 250
PspGI CCWGG 1 cut(s) 250
PspN4I GGNNCC 2 cut(s) 53, 78
PspPI GGNCC 2 cut(s) 51, 77
RsaI GTAC 1 cut(s) 104
RsaNI GTAC 1 cut(s) 103
SapI GCTCTTC 1 cut(s) 6
SaqAI TTAA 1 cut(s) 45
Sau3AI GATC 2 cut(s) 112, 205
Sau96I GGNCC 2 cut(s) 51, 77
ScaI AGTACT 1 cut(s) 104
ScrFI CCNGG 1 cut(s) 252
SduI GDGCHC 1 cut(s) 96
SetI ASST 7 cut(s) 18, 87, 138, 159, 168, 201, 256
SfaNI GCATC 1 cut(s) 18
SinI GGWCC 2 cut(s) 51, 77
SsiI CCGC 1 cut(s) 49
SspMI CTAG 2 cut(s) 17, 23
StyD4I CCNGG 1 cut(s) 250
TaaI ACNGT 2 cut(s) 59, 107
TaiI ACGT 1 cut(s) 159
TaqI TCGA 1 cut(s) 39
TatI WGTACW 1 cut(s) 102
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TseFI GTSAC 1 cut(s) 59
Tsp45I GTSAC 1 cut(s) 59
TspDTI ATGAA 1 cut(s) 113
VpaK11BI GGWCC 2 cut(s) 51, 77
XspI CTAG 2 cut(s) 17, 23
ZrmI AGTACT 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.