Rh2AG365700

Fanconi-associated nuclease 1 homolog

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
54184531 .. 54201996
17466 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG365700.1

Sequence Viewer

Length: 267 bp
ATGCTAGAGATTGTTGATCGATTTGTGTGGACAAATAGTTCAGAGGTCGATCCATGGAGAGAGTACACCTTTTGTGGGCTGGCAACAATGATTCTGATCAATGAGGTCAATTGTTTGGACTTGCCTAGACTAATTGTTGACAGTCCATCCGAAAACCCATTCAATAAGGACGAGATCAGTGAGGTGCCAGATTTATATCTTGGTGCTAGCATTCATCTCTCAAGAGATCCTAATAATGTTAAGAATCCCAATGCCATCCAGGATTAG

Protein Analysis

88

Amino Acids

10.05

Weight (kDa)

4.25

Isoelectric Point (pI)

36.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 184
AclWI GGATC 2 cut(s) 44, 221
AfaI GTAC 1 cut(s) 65
AfiI CCNNNNNNNGG 1 cut(s) 75
AgsI TTSAA 1 cut(s) 163
AjnI CCWGG 1 cut(s) 258
AloI GAACNNNNNNTCC 2 cut(s) 22, 54
AlwI GGATC 2 cut(s) 44, 221
AsuNHI GCTAGC 1 cut(s) 206
BanI GGYRCC 1 cut(s) 184
BccI CCATC 2 cut(s) 154, 263
BciT130I CCWGG 1 cut(s) 260
BclI TGATCA 1 cut(s) 96
BfaI CTAG 3 cut(s) 5, 126, 207
Bme1390I CCNGG 1 cut(s) 260
BmiI GGNNCC 1 cut(s) 186
BmrFI CCNGG 1 cut(s) 260
BmtI GCTAGC 1 cut(s) 210
BpuEI CTTGAG 1 cut(s) 205
Bsa29I ATCGAT 1 cut(s) 19
BsaBI GATNNNNATC 2 cut(s) 95, 195
BsaJI CCNNGG 1 cut(s) 53
Bsc4I CCNNNNNNNGG 1 cut(s) 75
Bse8I GATNNNNATC 2 cut(s) 95, 195
BseBI CCWGG 1 cut(s) 260
BseCI ATCGAT 1 cut(s) 19
BseDI CCNNGG 1 cut(s) 53
BseGI GGATG 2 cut(s) 146, 255
BseJI GATNNNNATC 2 cut(s) 95, 195
BseLI CCNNNNNNNGG 1 cut(s) 75
BshNI GGYRCC 1 cut(s) 184
BshVI ATCGAT 1 cut(s) 19
BslI CCNNNNNNNGG 1 cut(s) 75
BsmI GAATGC 1 cut(s) 210
Bsp143I GATC 5 cut(s) 16, 49, 96, 174, 226
Bsp19I CCATGG 1 cut(s) 53
BspDI ATCGAT 1 cut(s) 19
BspLI GGNNCC 1 cut(s) 186
BspOI GCTAGC 1 cut(s) 210
BspPI GGATC 2 cut(s) 44, 221
BspT107I GGYRCC 1 cut(s) 184
BssECI CCNNGG 1 cut(s) 53
BssMI GATC 5 cut(s) 16, 49, 96, 174, 226
BssT1I CCWWGG 1 cut(s) 53
Bst2UI CCWGG 1 cut(s) 260
Bst4CI ACNGT 1 cut(s) 143
BstC8I GCNNGC 2 cut(s) 81, 208
BstDSI CCRYGG 1 cut(s) 53
BstF5I GGATG 2 cut(s) 146, 255
BstKTI GATC 5 cut(s) 19, 52, 99, 177, 229
BstMBI GATC 5 cut(s) 16, 49, 96, 174, 226
BstNI CCWGG 1 cut(s) 260
BstSCI CCNGG 1 cut(s) 258
BstX2I RGATCY 1 cut(s) 226
BstYI RGATCY 1 cut(s) 226
Bsu15I ATCGAT 1 cut(s) 19
BsuTUI ATCGAT 1 cut(s) 19
BtgI CCRYGG 1 cut(s) 53
BtsCI GGATG 2 cut(s) 146, 255
BtsIMutI CAGTG 1 cut(s) 184
Cac8I GCNNGC 2 cut(s) 81, 208
ClaI ATCGAT 1 cut(s) 19
Csp6I GTAC 1 cut(s) 64
CviAII CATG 1 cut(s) 54
CviJI RGCY 1 cut(s) 79
CviKI_1 RGCY 1 cut(s) 79
CviQI GTAC 1 cut(s) 64
DpnI GATC 5 cut(s) 18, 51, 98, 176, 228
DpnII GATC 5 cut(s) 16, 49, 96, 174, 226
Eco130I CCWWGG 1 cut(s) 53
EcoRII CCWGG 1 cut(s) 258
EcoT14I CCWWGG 1 cut(s) 53
ErhI CCWWGG 1 cut(s) 53
FaeI CATG 1 cut(s) 57
FaiI YATR 2 cut(s) 55, 196
FatI CATG 1 cut(s) 53
FbaI TGATCA 1 cut(s) 96
FokI GGATG 2 cut(s) 133, 242
FspBI CTAG 3 cut(s) 5, 126, 207
Hin1II CATG 1 cut(s) 57
HincII GTYRAC 1 cut(s) 139
HindII GTYRAC 1 cut(s) 139
HinfI GANTC 2 cut(s) 91, 244
Hpy166II GTNNAC 3 cut(s) 30, 66, 139
Hpy188I TCNGA 3 cut(s) 43, 96, 151
Hpy188III TCNNGA 1 cut(s) 222
Hpy8I GTNNAC 3 cut(s) 30, 66, 139
HpyCH4III ACNGT 1 cut(s) 143
Hsp92II CATG 1 cut(s) 57
Ksp22I TGATCA 1 cut(s) 96
Kzo9I GATC 5 cut(s) 16, 49, 96, 174, 226
LpnPI CCDG 3 cut(s) 65, 201, 245
MaeI CTAG 3 cut(s) 5, 126, 207
MalI GATC 5 cut(s) 18, 51, 98, 176, 228
MboI GATC 5 cut(s) 16, 49, 96, 174, 226
MfeI CAATTG 1 cut(s) 109
MflI RGATCY 1 cut(s) 226
MluCI AATT 2 cut(s) 109, 132
MnlI CCTC 3 cut(s) 37, 97, 175
MseI TTAA 1 cut(s) 240
MspR9I CCNGG 1 cut(s) 260
MunI CAATTG 1 cut(s) 109
Mva1269I GAATGC 1 cut(s) 210
MvaI CCWGG 1 cut(s) 260
NcoI CCATGG 1 cut(s) 53
NdeII GATC 5 cut(s) 16, 49, 96, 174, 226
NheI GCTAGC 1 cut(s) 206
NlaIII CATG 1 cut(s) 57
NlaIV GGNNCC 1 cut(s) 186
PctI GAATGC 1 cut(s) 210
PfeI GAWTC 2 cut(s) 91, 244
PfoI TCCNGGA 1 cut(s) 258
Psp6I CCWGG 1 cut(s) 258
PspGI CCWGG 1 cut(s) 258
PspN4I GGNNCC 1 cut(s) 186
PsuI RGATCY 1 cut(s) 226
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
SaqAI TTAA 1 cut(s) 240
Sau3AI GATC 5 cut(s) 16, 49, 96, 174, 226
ScrFI CCNGG 1 cut(s) 260
SetI ASST 4 cut(s) 48, 71, 108, 186
SmlI CTYRAG 1 cut(s) 220
SmoI CTYRAG 1 cut(s) 220
Sse9I AATT 2 cut(s) 109, 132
SspMI CTAG 3 cut(s) 5, 126, 207
StyD4I CCNGG 1 cut(s) 258
StyI CCWWGG 1 cut(s) 53
TaaI ACNGT 1 cut(s) 143
TaqI TCGA 2 cut(s) 19, 48
TasI AATT 2 cut(s) 109, 132
TatI WGTACW 1 cut(s) 63
TfiI GAWTC 2 cut(s) 91, 244
Tru1I TTAA 1 cut(s) 240
Tru9I TTAA 1 cut(s) 240
TscAI CASTG 1 cut(s) 184
TspDTI ATGAA 1 cut(s) 203
TspRI CASTG 1 cut(s) 184
XspI CTAG 3 cut(s) 5, 126, 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.