AT3G46860

Potato inhibitor I family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0014904
Physical Location & Seq
Forward (+)
17260234 .. 17260599
366 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G46860.1

Sequence Viewer

Length: 258 bp
ATGTCTCGCTATCCTCCATGTTGGTCTGGCTCTTGCGAAGATCCAGAGTGTTGTGCTATAGGAAAGAAGTATAGGTGGCCAGAACTGGTTGGGAAAAATGGACAATTGGCGAAAATGACGATCGAAAGAGAAAATCCTAATGTGTTAGCGATTGTCCTTCGATATGGAGAAAAGCGGATTGAAAACTTTTGCTGCAACAGGGTCTTTGTTTATTTAGGTTCCAACGGCCAAGTTGCAGATGCTCCTATGATCGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
potato_inhibit

Protein Analysis

85

Amino Acids

9.57

Weight (kDa)

8.25

Isoelectric Point (pI)

48.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
potato_inhibit PF00280 23 - 85 8.4e-21 Potato inhibitor I family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014904)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G46860 AT3G50020 AT5G45277
fragaria_vesca FvH4_1g16190
malus_domestica MD15G1392900.v1.1
pyrus_communis pycom08g17930
rosa_chinensis RchiOBHm_Chr2g0105871 RchiOBHm_Chr6g0294471
rosa_roxburghii Rroxscaffold_2G00137770 Rroxscaffold_3G00227700 Rroxscaffold_5G00335710
rosa_rugosa Rorug02G0131200 Rorug02G0131400 Rorug07G0278000
rosa_samantha Rh2BG191900
rosa_wichuraiana Rw6G031180

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 175
AclWI GGATC 1 cut(s) 35
AcoI YGGCCR 2 cut(s) 77, 226
AfiI CCNNNNNNNGG 1 cut(s) 251
AgsI TTSAA 1 cut(s) 182
Alw26I GTCTC 1 cut(s) 9
AlwI GGATC 1 cut(s) 35
AoxI GGCC 2 cut(s) 77, 226
ApeKI GCWGC 1 cut(s) 192
BalI TGGCCA 1 cut(s) 79
BbvI GCAGC 1 cut(s) 179
BceAI ACGGC 1 cut(s) 241
BcoDI GTCTC 1 cut(s) 9
BfmI CTRYAG 1 cut(s) 57
BisI GCNGC 1 cut(s) 193
BlsI GCNGC 1 cut(s) 194
BmiI GGNNCC 1 cut(s) 220
BmsI GCATC 1 cut(s) 229
Bsc4I CCNNNNNNNGG 1 cut(s) 251
Bse1I ACTGG 1 cut(s) 90
BseLI CCNNNNNNNGG 1 cut(s) 251
BseNI ACTGG 1 cut(s) 90
BseXI GCAGC 1 cut(s) 179
Bsh1285I CGRYCG 1 cut(s) 123
BshFI GGCC 2 cut(s) 79, 228
BsiEI CGRYCG 1 cut(s) 123
BslI CCNNNNNNNGG 1 cut(s) 251
BsmAI GTCTC 1 cut(s) 9
BsnI GGCC 2 cut(s) 79, 228
Bsp143I GATC 3 cut(s) 40, 120, 249
BspACI CCGC 1 cut(s) 175
BspANI GGCC 2 cut(s) 79, 228
BspLI GGNNCC 1 cut(s) 220
BspPI GGATC 1 cut(s) 35
BsrI ACTGG 1 cut(s) 90
BssMI GATC 3 cut(s) 40, 120, 249
BstKTI GATC 3 cut(s) 43, 123, 252
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 3 cut(s) 40, 120, 249
BstMCI CGRYCG 1 cut(s) 123
BstSFI CTRYAG 1 cut(s) 57
BstV1I GCAGC 1 cut(s) 179
BstX2I RGATCY 1 cut(s) 40
BstYI RGATCY 1 cut(s) 40
BsuRI GGCC 2 cut(s) 79, 228
CviAII CATG 1 cut(s) 18
CviJI RGCY 3 cut(s) 30, 79, 228
CviKI_1 RGCY 3 cut(s) 30, 79, 228
DpnI GATC 3 cut(s) 42, 122, 251
DpnII GATC 3 cut(s) 40, 120, 249
EaeI YGGCCR 2 cut(s) 77, 226
FaeI CATG 1 cut(s) 21
FaiI YATR 5 cut(s) 19, 59, 72, 165, 248
FatI CATG 1 cut(s) 17
Fnu4HI GCNGC 1 cut(s) 193
Fsp4HI GCNGC 1 cut(s) 193
GluI GCNGC 1 cut(s) 193
HaeIII GGCC 2 cut(s) 79, 228
Hin1II CATG 1 cut(s) 21
Hpy188III TCNNGA 1 cut(s) 44
HpyAV CCTTC 1 cut(s) 167
HpyCH4V TGCA 2 cut(s) 195, 236
Hsp92II CATG 1 cut(s) 21
Kzo9I GATC 3 cut(s) 40, 120, 249
LmnI GCTCC 1 cut(s) 247
LpnPI CCDG 5 cut(s) 12, 57, 71, 93, 184
Lsp1109I GCAGC 1 cut(s) 179
LweI GCATC 1 cut(s) 229
MalI GATC 3 cut(s) 42, 122, 251
MboI GATC 3 cut(s) 40, 120, 249
MboII GAAGA 1 cut(s) 50
MfeI CAATTG 1 cut(s) 104
MflI RGATCY 1 cut(s) 40
MlsI TGGCCA 1 cut(s) 79
MluCI AATT 1 cut(s) 104
MluNI TGGCCA 1 cut(s) 79
MmeI TCCRAC 1 cut(s) 246
MnlI CCTC 1 cut(s) 24
Mox20I TGGCCA 1 cut(s) 79
MscI TGGCCA 1 cut(s) 79
Msp20I TGGCCA 1 cut(s) 79
MunI CAATTG 1 cut(s) 104
NdeII GATC 3 cut(s) 40, 120, 249
NlaIII CATG 1 cut(s) 21
NlaIV GGNNCC 1 cut(s) 220
PkrI GCNGC 1 cut(s) 194
Ple19I CGATCG 1 cut(s) 123
PspN4I GGNNCC 1 cut(s) 220
PsuI RGATCY 1 cut(s) 40
PvuI CGATCG 1 cut(s) 123
SatI GCNGC 1 cut(s) 193
Sau3AI GATC 3 cut(s) 40, 120, 249
SetI ASST 2 cut(s) 77, 220
SfaNI GCATC 1 cut(s) 229
SfcI CTRYAG 1 cut(s) 57
SgeI CNNG 9 cut(s) 18, 30, 39, 45, 56, 92, 98, 211, 242
Sse9I AATT 1 cut(s) 104
SsiI CCGC 1 cut(s) 175
TaqI TCGA 2 cut(s) 123, 160
TasI AATT 1 cut(s) 104
TseI GCWGC 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.