Rroxscaffold_2G00137770

Potato inhibitor I family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
75795441 .. 75795792
352 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00137770.1

Sequence Viewer

Length: 261 bp
ATGTCTGATCCTTACCCTCCTTGTAACAACGGAGCAGTGCCATGCCACAGTCAAGCAAAATACAAACAAATATGGCTTGAACTAGTTGGAAAGCCTGTGCAGCTTGCCAAAACAATAATCGAGAAGGACAATCCATTTGTTACTGCAGAGATCATAAAACCAGGCATGGGGATAATTTTTAACTATTGCTGCAACCGTGTATGGATTTGGGAAGATAACCTTGGCAATGTTGCAGAACACCATATACCAAAAATAGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.7

Weight (kDa)

6.8

Isoelectric Point (pI)

35.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
potato_inhibit PF00280 22 - 86 3.2e-17 Potato inhibitor I family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014904)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 2
AfiI CCNNNNNNNGG 2 cut(s) 167, 254
AgsI TTSAA 1 cut(s) 80
AhlI ACTAGT 1 cut(s) 82
AjnI CCWGG 1 cut(s) 160
AjuI GAANNNNNNNTTGG 2 cut(s) 204, 236
AluBI AGCT 1 cut(s) 103
AluI AGCT 1 cut(s) 103
AlwI GGATC 1 cut(s) 2
ApeKI GCWGC 2 cut(s) 100, 189
ArsI GACNNNNNNTTYG 2 cut(s) 119, 151
BbvI GCAGC 2 cut(s) 112, 176
BciT130I CCWGG 1 cut(s) 162
BcuI ACTAGT 1 cut(s) 82
BfaI CTAG 1 cut(s) 83
BfmI CTRYAG 1 cut(s) 144
BisI GCNGC 2 cut(s) 101, 190
BlsI GCNGC 2 cut(s) 102, 191
Bme1390I CCNGG 1 cut(s) 162
BmrFI CCNGG 1 cut(s) 162
BsaJI CCNNGG 1 cut(s) 220
Bsc4I CCNNNNNNNGG 2 cut(s) 167, 254
Bse3DI GCAATG 1 cut(s) 232
BseBI CCWGG 1 cut(s) 162
BseDI CCNNGG 1 cut(s) 220
BseLI CCNNNNNNNGG 2 cut(s) 167, 254
BseMI GCAATG 1 cut(s) 232
BseXI GCAGC 2 cut(s) 112, 176
BsgI GTGCAG 1 cut(s) 119
BslI CCNNNNNNNGG 2 cut(s) 167, 254
Bsp143I GATC 2 cut(s) 7, 150
BspMAI CTGCAG 1 cut(s) 148
BspPI GGATC 1 cut(s) 2
BsrDI GCAATG 1 cut(s) 232
BssECI CCNNGG 1 cut(s) 220
BssMI GATC 2 cut(s) 7, 150
BssT1I CCWWGG 1 cut(s) 220
Bst2UI CCWGG 1 cut(s) 162
Bst4CI ACNGT 2 cut(s) 50, 197
BstC8I GCNNGC 1 cut(s) 105
BstKTI GATC 2 cut(s) 10, 153
BstMBI GATC 2 cut(s) 7, 150
BstMWI GCNNNNNNNGC 1 cut(s) 100
BstNI CCWGG 1 cut(s) 162
BstSCI CCNGG 1 cut(s) 160
BstSFI CTRYAG 1 cut(s) 144
BstV1I GCAGC 2 cut(s) 112, 176
BtsI GCAGTG 1 cut(s) 42
BtsIMutI CAGTG 1 cut(s) 42
Cac8I GCNNGC 1 cut(s) 105
CviAII CATG 2 cut(s) 42, 166
CviJI RGCY 4 cut(s) 76, 94, 103, 258
CviKI_1 RGCY 4 cut(s) 76, 94, 103, 258
DpnI GATC 2 cut(s) 9, 152
DpnII GATC 2 cut(s) 7, 150
Eco130I CCWWGG 1 cut(s) 220
EcoRII CCWGG 1 cut(s) 160
EcoT14I CCWWGG 1 cut(s) 220
ErhI CCWWGG 1 cut(s) 220
FaeI CATG 2 cut(s) 45, 169
FaiI YATR 7 cut(s) 43, 73, 155, 167, 202, 243, 245
FalI AAGNNNNNCTT 2 cut(s) 204, 236
FatI CATG 2 cut(s) 41, 165
Fnu4HI GCNGC 2 cut(s) 101, 190
Fsp4HI GCNGC 2 cut(s) 101, 190
FspBI CTAG 1 cut(s) 83
GluI GCNGC 2 cut(s) 101, 190
Hin1II CATG 2 cut(s) 45, 169
Hpy188I TCNGA 1 cut(s) 7
Hpy188III TCNNGA 1 cut(s) 121
HpyAV CCTTC 1 cut(s) 118
HpyCH4III ACNGT 2 cut(s) 50, 197
HpyCH4V TGCA 4 cut(s) 100, 146, 192, 233
HpyF10VI GCNNNNNNNGC 1 cut(s) 100
Hsp92II CATG 2 cut(s) 45, 169
Kzo9I GATC 2 cut(s) 7, 150
LmnI GCTCC 1 cut(s) 32
LpnPI CCDG 3 cut(s) 108, 147, 174
Lsp1109I GCAGC 2 cut(s) 112, 176
MaeI CTAG 1 cut(s) 83
MaeIII GTNAC 2 cut(s) 23, 139
MalI GATC 2 cut(s) 9, 152
MboI GATC 2 cut(s) 7, 150
MboII GAAGA 1 cut(s) 224
MluCI AATT 1 cut(s) 174
MmeI TCCRAC 1 cut(s) 67
MnlI CCTC 1 cut(s) 27
MseI TTAA 1 cut(s) 180
MspR9I CCNGG 1 cut(s) 162
MvaI CCWGG 1 cut(s) 162
MwoI GCNNNNNNNGC 1 cut(s) 100
NdeII GATC 2 cut(s) 7, 150
NlaIII CATG 2 cut(s) 45, 169
PkrI GCNGC 2 cut(s) 102, 191
Psp6I CCWGG 1 cut(s) 160
PspGI CCWGG 1 cut(s) 160
PsrI GAACNNNNNNTAC 2 cut(s) 228, 260
PstI CTGCAG 1 cut(s) 148
SaqAI TTAA 1 cut(s) 180
SatI GCNGC 2 cut(s) 101, 190
Sau3AI GATC 2 cut(s) 7, 150
ScrFI CCNGG 1 cut(s) 162
SetI ASST 2 cut(s) 105, 222
SfcI CTRYAG 1 cut(s) 144
SpeI ACTAGT 1 cut(s) 82
Sse9I AATT 1 cut(s) 174
SspMI CTAG 1 cut(s) 83
StyD4I CCNGG 1 cut(s) 160
StyI CCWWGG 1 cut(s) 220
TaaI ACNGT 2 cut(s) 50, 197
TaqI TCGA 1 cut(s) 120
TasI AATT 1 cut(s) 174
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
TscAI CASTG 1 cut(s) 42
TseI GCWGC 2 cut(s) 100, 189
TspGWI ACGGA 1 cut(s) 45
TspRI CASTG 1 cut(s) 42
XspI CTAG 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.