RchiOBHm_Chr6g0294471

Potato inhibitor I family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
56776634 .. 56777904
1271 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ26429

Sequence Viewer

Length: 258 bp
ATGTCTGATCCTTACCCTCCTTGTGATGGCGGAGAACTTGGATGCCCCAGTCTAAGATACAAATATTCATGGCCTGAGTTAGTTGGTAAACCTGGGAAATTAGCTAAACAAATAATAGAGAAGGACAACCACTTTGTTACAGTCTTGATCCTAAAACCAGGCGATTCAATAACTGGAGACCGTTGTTGCAACCGTGTGTATTTTTGGGTGGATGACCATGGCAATGTTACAAGCTACTATCCACCCAGAATAGGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.58

Weight (kDa)

6.69

Isoelectric Point (pI)

27.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
potato_inhibit PF00280 21 - 85 7.7e-20 Potato inhibitor I family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014904)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 30
AclWI GGATC 2 cut(s) 2, 142
AfiI CCNNNNNNNGG 3 cut(s) 26, 251, 252
AgsI TTSAA 1 cut(s) 168
AjnI CCWGG 2 cut(s) 91, 157
AluBI AGCT 2 cut(s) 104, 234
AluI AGCT 2 cut(s) 104, 234
Alw26I GTCTC 1 cut(s) 171
AlwI GGATC 2 cut(s) 2, 142
AoxI GGCC 1 cut(s) 71
ArsI GACNNNNNNTTYG 2 cut(s) 116, 148
BccI CCATC 1 cut(s) 20
BciT130I CCWGG 2 cut(s) 93, 159
BcoDI GTCTC 1 cut(s) 171
Bme1390I CCNGG 2 cut(s) 93, 159
BmrFI CCNGG 2 cut(s) 93, 159
BmrI ACTGGG 1 cut(s) 42
BmsI GCATC 1 cut(s) 32
BmuI ACTGGG 1 cut(s) 42
BpmI CTGGAG 1 cut(s) 195
BsaI GGTCTC 1 cut(s) 171
BsaJI CCNNGG 2 cut(s) 92, 217
Bsc4I CCNNNNNNNGG 3 cut(s) 26, 251, 252
Bse1I ACTGG 2 cut(s) 48, 178
Bse3DI GCAATG 1 cut(s) 229
BseBI CCWGG 2 cut(s) 93, 159
BseDI CCNNGG 2 cut(s) 92, 217
BseGI GGATG 2 cut(s) 47, 217
BseLI CCNNNNNNNGG 3 cut(s) 26, 251, 252
BseMI GCAATG 1 cut(s) 229
BseMII CTCAG 1 cut(s) 66
BseNI ACTGG 2 cut(s) 48, 178
BshFI GGCC 1 cut(s) 73
BslI CCNNNNNNNGG 3 cut(s) 26, 251, 252
BsmAI GTCTC 1 cut(s) 171
BsnI GGCC 1 cut(s) 73
Bso31I GGTCTC 1 cut(s) 171
Bsp143I GATC 2 cut(s) 7, 147
Bsp19I CCATGG 1 cut(s) 217
BspACI CCGC 1 cut(s) 30
BspANI GGCC 1 cut(s) 73
BspCNI CTCAG 1 cut(s) 67
BspPI GGATC 2 cut(s) 2, 142
BspTNI GGTCTC 1 cut(s) 171
BsrDI GCAATG 1 cut(s) 229
BsrI ACTGG 2 cut(s) 48, 178
BssECI CCNNGG 2 cut(s) 92, 217
BssMI GATC 2 cut(s) 7, 147
BssT1I CCWWGG 1 cut(s) 217
Bst2UI CCWGG 2 cut(s) 93, 159
Bst4CI ACNGT 3 cut(s) 142, 182, 194
BstDEI CTNAG 2 cut(s) 53, 75
BstDSI CCRYGG 1 cut(s) 217
BstF5I GGATG 2 cut(s) 47, 217
BstKTI GATC 2 cut(s) 10, 150
BstMAI GTCTC 1 cut(s) 171
BstMBI GATC 2 cut(s) 7, 147
BstNI CCWGG 2 cut(s) 93, 159
BstSCI CCNGG 2 cut(s) 91, 157
BsuRI GGCC 1 cut(s) 73
BtgI CCRYGG 1 cut(s) 217
BtsCI GGATG 2 cut(s) 47, 217
CviAII CATG 2 cut(s) 69, 218
CviJI RGCY 3 cut(s) 73, 104, 234
CviKI_1 RGCY 3 cut(s) 73, 104, 234
DdeI CTNAG 2 cut(s) 53, 75
DpnI GATC 2 cut(s) 9, 149
DpnII GATC 2 cut(s) 7, 147
EciI GGCGGA 1 cut(s) 45
Eco130I CCWWGG 1 cut(s) 217
Eco31I GGTCTC 1 cut(s) 171
EcoRII CCWGG 2 cut(s) 91, 157
EcoT14I CCWWGG 1 cut(s) 217
ErhI CCWWGG 1 cut(s) 217
FaeI CATG 2 cut(s) 72, 221
FaiI YATR 2 cut(s) 70, 219
FatI CATG 2 cut(s) 68, 217
FokI GGATG 2 cut(s) 54, 224
GsuI CTGGAG 1 cut(s) 195
HaeIII GGCC 1 cut(s) 73
Hin1II CATG 2 cut(s) 72, 221
HinfI GANTC 1 cut(s) 164
Hpy166II GTNNAC 1 cut(s) 89
Hpy188I TCNGA 1 cut(s) 7
Hpy188III TCNNGA 1 cut(s) 145
Hpy8I GTNNAC 1 cut(s) 89
HpyAV CCTTC 1 cut(s) 115
HpyCH4III ACNGT 3 cut(s) 142, 182, 194
HpyCH4V TGCA 1 cut(s) 189
HpyF3I CTNAG 2 cut(s) 53, 75
Hsp92II CATG 2 cut(s) 72, 221
Kzo9I GATC 2 cut(s) 7, 147
LpnPI CCDG 7 cut(s) 61, 78, 87, 105, 144, 159, 171
LweI GCATC 1 cut(s) 32
MaeIII GTNAC 2 cut(s) 136, 226
MalI GATC 2 cut(s) 9, 149
MboI GATC 2 cut(s) 7, 147
MluCI AATT 1 cut(s) 98
MnlI CCTC 1 cut(s) 27
MslI CAYNNNNRTG 1 cut(s) 222
MspR9I CCNGG 2 cut(s) 93, 159
MvaI CCWGG 2 cut(s) 93, 159
NcoI CCATGG 1 cut(s) 217
NdeII GATC 2 cut(s) 7, 147
NlaIII CATG 2 cut(s) 72, 221
PfeI GAWTC 1 cut(s) 164
Psp6I CCWGG 2 cut(s) 91, 157
PspGI CCWGG 2 cut(s) 91, 157
RseI CAYNNNNRTG 1 cut(s) 222
Sau3AI GATC 2 cut(s) 7, 147
ScrFI CCNGG 2 cut(s) 93, 159
SetI ASST 3 cut(s) 94, 106, 236
SfaNI GCATC 1 cut(s) 32
SmiMI CAYNNNNRTG 1 cut(s) 222
Sse9I AATT 1 cut(s) 98
SsiI CCGC 1 cut(s) 30
SspI AATATT 1 cut(s) 65
StyD4I CCNGG 2 cut(s) 91, 157
StyI CCWWGG 1 cut(s) 217
TaaI ACNGT 3 cut(s) 142, 182, 194
TasI AATT 1 cut(s) 98
TfiI GAWTC 1 cut(s) 164
TspDTI ATGAA 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.