Basic Information

Type: gene

Biological Identity

Species

arabidopsis_thaliana

Chromosome

Orthogroup ID

OG0014904

Physical Location & Seq

Genomic Coordinates Reverse (-)

18341634 .. 18341840

Gene Structure 207 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

AT5G45277.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 207 bp

ATGAAGGTGGAGTGGCCAGAGCTAAGAGGAGTGAGTGGACTTCAAGCAAAGGCAACAATAGAAAGTGACAATCCACTTGTGACTGCTTTCATTTACCCTCAAGGTGTTTATTTACCATCGATCAATTGTTGCAACCGTGTTATTCTCTATGTTCCAGCCGAAGATTGTCCTAATGGTCCTGTCCAAAACCGTCTACTCGTCGGATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

potato_inhibit

Protein Analysis

68

Amino Acids

7.46

Weight (kDa)

5.05

Isoelectric Point (pI)

45.26

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
potato_inhibit	PF00280	2 - 53	2.4e-16	Potato inhibitor I family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014904)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G46860 AT3G50020 AT5G45277
fragaria_vesca	FvH4_1g16190
malus_domestica	MD15G1392900.v1.1
pyrus_communis	pycom08g17930
rosa_chinensis	RchiOBHm_Chr2g0105871 RchiOBHm_Chr6g0294471
rosa_roxburghii	Rroxscaffold_2G00137770 Rroxscaffold_3G00227700 Rroxscaffold_5G00335710
rosa_rugosa	Rorug02G0131200 Rorug02G0131400 Rorug07G0278000
rosa_samantha	Rh2BG191900
rosa_wichuraiana	Rw6G031180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	193
AcoI	YGGCCR	1 cut(s)	14
AgsI	TTSAA	1 cut(s)	44
AluBI	AGCT	1 cut(s)	22
AluI	AGCT	1 cut(s)	22
AoxI	GGCC	1 cut(s)	14
AspS9I	GGNCC	1 cut(s)	176
AvaII	GGWCC	1 cut(s)	176
BalI	TGGCCA	1 cut(s)	16
BccI	CCATC	1 cut(s)	124
Bme18I	GGWCC	1 cut(s)	176
BmgT120I	GGNCC	1 cut(s)	176
BpuEI	CTTGAG	1 cut(s)	84
Bsa29I	ATCGAT	1 cut(s)	119
BseCI	ATCGAT	1 cut(s)	119
BseRI	GAGGAG	1 cut(s)	42
BshFI	GGCC	1 cut(s)	16
BshVI	ATCGAT	1 cut(s)	119
BsnI	GGCC	1 cut(s)	16
Bsp143I	GATC	1 cut(s)	120
BspANI	GGCC	1 cut(s)	16
BspDI	ATCGAT	1 cut(s)	119
BssMI	GATC	1 cut(s)	120
Bst4CI	ACNGT	2 cut(s)	137, 191
BstDEI	CTNAG	1 cut(s)	23
BstKTI	GATC	1 cut(s)	123
BstMBI	GATC	1 cut(s)	120
Bsu15I	ATCGAT	1 cut(s)	119
BsuRI	GGCC	1 cut(s)	16
BsuTUI	ATCGAT	1 cut(s)	119
Cfr13I	GGNCC	1 cut(s)	176
ClaI	ATCGAT	1 cut(s)	119
CviJI	RGCY	3 cut(s)	16, 22, 158
CviKI_1	RGCY	3 cut(s)	16, 22, 158
DdeI	CTNAG	1 cut(s)	23
DpnI	GATC	1 cut(s)	122
DpnII	GATC	1 cut(s)	120
EaeI	YGGCCR	1 cut(s)	14
Eco47I	GGWCC	1 cut(s)	176
FaiI	YATR	1 cut(s)	150
FblI	GTMKAC	1 cut(s)	193
HaeIII	GGCC	1 cut(s)	16
Hpy166II	GTNNAC	2 cut(s)	38, 194
Hpy188I	TCNGA	1 cut(s)	203
Hpy8I	GTNNAC	2 cut(s)	38, 194
Hpy99I	CGWCG	1 cut(s)	203
HpyCH4III	ACNGT	2 cut(s)	137, 191
HpyCH4V	TGCA	1 cut(s)	132
HpyF3I	CTNAG	1 cut(s)	23
Kzo9I	GATC	1 cut(s)	120
LpnPI	CCDG	3 cut(s)	30, 168, 192
MaeIII	GTNAC	2 cut(s)	65, 79
MalI	GATC	1 cut(s)	122
MboI	GATC	1 cut(s)	120
MboII	GAAGA	1 cut(s)	173
MfeI	CAATTG	1 cut(s)	124
MlsI	TGGCCA	1 cut(s)	16
MluCI	AATT	1 cut(s)	124
MluNI	TGGCCA	1 cut(s)	16
MmeI	TCCRAC	1 cut(s)	181
MnlI	CCTC	2 cut(s)	20, 108
Mox20I	TGGCCA	1 cut(s)	16
MscI	TGGCCA	1 cut(s)	16
Msp20I	TGGCCA	1 cut(s)	16
MunI	CAATTG	1 cut(s)	124
NdeII	GATC	1 cut(s)	120
NmuCI	GTSAC	2 cut(s)	65, 79
PspPI	GGNCC	1 cut(s)	176
Sau3AI	GATC	1 cut(s)	120
Sau96I	GGNCC	1 cut(s)	176
SetI	ASST	3 cut(s)	9, 24, 106
SgeI	CNNG	7 cut(s)	29, 56, 89, 113, 149, 167, 191
SinI	GGWCC	1 cut(s)	176
SmlI	CTYRAG	1 cut(s)	99
SmoI	CTYRAG	1 cut(s)	99
Sse9I	AATT	1 cut(s)	124
TaaI	ACNGT	2 cut(s)	137, 191
TaqI	TCGA	1 cut(s)	119
TasI	AATT	1 cut(s)	124
TseFI	GTSAC	2 cut(s)	65, 79
Tsp45I	GTSAC	2 cut(s)	65, 79
TspDTI	ATGAA	2 cut(s)	17, 79
VpaK11BI	GGWCC	1 cut(s)	176
XmiI	GTMKAC	1 cut(s)	193

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.