AT5G35490

Plant transposon protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Forward (+)
13689817 .. 13690548
732 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G35490.1

Sequence Viewer

Length: 153 bp
ATGGGGAGGGAAAATCAAATTGCGGTCAATTTATTAGTTTACAACAATCGGCTTATTCACCAACTCACTCGAAATAGCAATCACTTTCTCGGTCGTAGTGGATCTCCCACAATTATTCTTGAAGCTATTGCTTATTACGATCTATGGATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.8

Weight (kDa)

8.29

Isoelectric Point (pI)

43.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 23
AclWI GGATC 1 cut(s) 109
AgsI TTSAA 1 cut(s) 122
AluBI AGCT 1 cut(s) 125
AluI AGCT 1 cut(s) 125
AlwI GGATC 1 cut(s) 109
AsuHPI GGTGA 1 cut(s) 50
Bsh1285I CGRYCG 1 cut(s) 94
BsiEI CGRYCG 1 cut(s) 94
Bsp143I GATC 2 cut(s) 101, 139
BspACI CCGC 1 cut(s) 23
BspPI GGATC 1 cut(s) 109
BssMI GATC 2 cut(s) 101, 139
BstKTI GATC 2 cut(s) 104, 142
BstMBI GATC 2 cut(s) 101, 139
BstMCI CGRYCG 1 cut(s) 94
BstX2I RGATCY 1 cut(s) 101
BstYI RGATCY 1 cut(s) 101
CviJI RGCY 2 cut(s) 52, 125
CviKI_1 RGCY 2 cut(s) 52, 125
DpnI GATC 2 cut(s) 103, 141
DpnII GATC 2 cut(s) 101, 139
FaiI YATR 2 cut(s) 145, 151
FspEI CC 8 cut(s) 8, 34, 74, 75, 84, 120, 121, 130
HphI GGTGA 1 cut(s) 50
Hpy166II GTNNAC 1 cut(s) 40
Hpy188III TCNNGA 1 cut(s) 119
Hpy8I GTNNAC 1 cut(s) 40
Kzo9I GATC 2 cut(s) 101, 139
MalI GATC 2 cut(s) 103, 141
MboI GATC 2 cut(s) 101, 139
MflI RGATCY 1 cut(s) 101
MluCI AATT 3 cut(s) 18, 28, 111
NdeII GATC 2 cut(s) 101, 139
PsuI RGATCY 1 cut(s) 101
Sau3AI GATC 2 cut(s) 101, 139
SetI ASST 1 cut(s) 127
SgeI CNNG 3 cut(s) 81, 101, 131
Sse9I AATT 3 cut(s) 18, 28, 111
SsiI CCGC 1 cut(s) 23
TaqI TCGA 1 cut(s) 70
TaqII GACCGA 1 cut(s) 80
TasI AATT 3 cut(s) 18, 28, 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.