Rmu_sc0000149.1_g000031

Ribosomal protein-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000149.1
Physical Location & Seq
Forward (+)
112117 .. 113465
1349 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000149.1_g000031.1.cds

Sequence Viewer

Length: 1290 bp
atggattcatcccaaatatcatcatcctctctttcttcaaatggaaccgttgagtattgcaattctgtcttggccgcatttgatcgggagcaagatttgttacttcgtatgtgtgctaacaacaatctcctcttagcagaaaatctcgacaatgaagaagatgatgctcaatcatgtcggagaggtgcaattcctgattattttgcggaggtcccccgatttggtgagcaaaaatttcgcagacgttttcgaatgagtaaaagtttattttatcggattgctgatgcggtcaaaaatcatgacaatttctttatgaaacaacgcgatggaattggtaggctcagattgtcatcctttgtaaaaatcacagctgtttttcgaatgcttgcatatggtgtaccagctgattctctcgatgaatacttaaaaattggtgagtccacagcaattagatgcatgaaaaagttttgtcgggctattgtagaaatatttggagagcaatatctcagaaaaccaacagctattgatgttgcaagactccttcatattggtgaagaacgtgggtttccaggaatgttaggaagcttagactgcatgcactggaggtggaaaaattgtccagcagcttgggcaggtgcttatgtagggcgtagtggatcgccaacaattattctagaagcaggtgctgattatgatctttggatatggcatgcatattttggtttaccaggctccaacaatgacatcaatgttttggaagcatcctacttatttgcggagcttgctgcaggtaaatcacctccatgtcattattttattaaggataaagcatatgatgtcggttattacttagctgatggcatatatcccaagtggtccacacttgttcaaacaattcatgatcctcaaggacgaaaaaaacaattttttgccacaaagcaagaagcatgtaggaaagatgttgaacgtgcttttggagttcttcaatcacgttgggcaattgttaagggtgcagcacgtttttgggataaacgtgttttacatgatataatgactacatgcatcattatgcacaatatgatcattgaggatgagcatgatttgacagctccgattagagaatttaatcaagcgccagctcctactgttgagatgatcgttgatgaagatgcacgatttaatcagtttcttgctcgaaataggcaaatcaaagacaagacggctcattttgaacttcgggatgcattgattgatcatctgtgggatcgtcatggcagagatgaagcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

429

Amino Acids

49.17

Weight (kDa)

6.65

Isoelectric Point (pI)

48.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 2 cut(s) 623, 671
Acc36I ACCTGC 3 cut(s) 623, 671, 779
AccII CGCG 1 cut(s) 324
AciI CCGC 4 cut(s) 75, 206, 287, 776
AclWI GGATC 3 cut(s) 664, 896, 1272
AcoI YGGCCR 1 cut(s) 72
AcsI RAATTY 2 cut(s) 233, 1121
AfaI GTAC 1 cut(s) 399
AfiI CCNNNNNNNGG 1 cut(s) 221
AflIII ACRYGT 1 cut(s) 1033
AgsI TTSAA 5 cut(s) 39, 890, 965, 986, 1232
AjnI CCWGG 2 cut(s) 568, 727
AjuI GAANNNNNNNTTGG 2 cut(s) 957, 989
AlwI GGATC 3 cut(s) 664, 896, 1272
AlwNI CAGNNNCTG 1 cut(s) 686
AoxI GGCC 1 cut(s) 72
ApeKI GCWGC 3 cut(s) 623, 785, 1013
ApoI RAATTY 2 cut(s) 233, 1121
AspLEI GCGC 1 cut(s) 1135
AspS9I GGNCC 2 cut(s) 211, 876
AsuHPI GGTGA 4 cut(s) 236, 446, 563, 789
AsuII TTCGAA 2 cut(s) 250, 379
AvaII GGWCC 2 cut(s) 211, 876
BbvI GCAGC 3 cut(s) 635, 772, 1025
BccI CCATC 2 cut(s) 320, 851
BceAI ACGGC 1 cut(s) 1236
BcgI CGANNNNNNTGC 2 cut(s) 218, 252
BciT130I CCWGG 2 cut(s) 570, 729
BclI TGATCA 2 cut(s) 1080, 1252
BfaI CTAG 1 cut(s) 674
BfmI CTRYAG 1 cut(s) 786
BfoI RGCGCY 1 cut(s) 1136
BfuAI ACCTGC 3 cut(s) 623, 671, 779
BisI GCNGC 4 cut(s) 75, 624, 786, 1014
BlsI GCNGC 4 cut(s) 76, 625, 787, 1015
Bme1390I CCNGG 2 cut(s) 570, 729
Bme18I GGWCC 2 cut(s) 211, 876
BmgT120I GGNCC 2 cut(s) 211, 876
BmiI GGNNCC 3 cut(s) 46, 213, 733
BmrFI CCNGG 2 cut(s) 570, 729
BmsI GCATC 7 cut(s) 154, 274, 443, 770, 1071, 1159, 1231
BpmI CTGGAG 1 cut(s) 622
Bpu14I TTCGAA 2 cut(s) 250, 379
BpuEI CTTGAG 1 cut(s) 891
BsaBI GATNNNNATC 2 cut(s) 349, 693
Bsc4I CCNNNNNNNGG 1 cut(s) 221
Bse1I ACTGG 1 cut(s) 605
Bse8I GATNNNNATC 2 cut(s) 349, 693
BseBI CCWGG 2 cut(s) 570, 729
BseGI GGATG 6 cut(s) 8, 23, 350, 761, 1096, 1246
BseJI GATNNNNATC 2 cut(s) 349, 693
BseLI CCNNNNNNNGG 1 cut(s) 221
BseMII CTCAG 2 cut(s) 355, 520
BseNI ACTGG 1 cut(s) 605
BseRI GAGGAG 1 cut(s) 119
BseXI GCAGC 3 cut(s) 635, 772, 1025
BsgI GTGCAG 1 cut(s) 1032
Bsh1236I CGCG 1 cut(s) 324
BshFI GGCC 1 cut(s) 74
BslFI GGGAC 1 cut(s) 197
BslI CCNNNNNNNGG 1 cut(s) 221
BsmFI GGGAC 1 cut(s) 197
BsmI GAATGC 1 cut(s) 387
BsnI GGCC 1 cut(s) 74
Bsp119I TTCGAA 2 cut(s) 250, 379
Bsp143I GATC 8 cut(s) 82, 656, 694, 901, 1080, 1155, 1252, 1264
BspACI CCGC 4 cut(s) 75, 206, 287, 776
BspANI GGCC 1 cut(s) 74
BspCNI CTCAG 2 cut(s) 354, 519
BspFNI CGCG 1 cut(s) 324
BspHI TCATGA 2 cut(s) 298, 898
BspLI GGNNCC 3 cut(s) 46, 213, 733
BspMAI CTGCAG 1 cut(s) 790
BspMI ACCTGC 3 cut(s) 623, 671, 779
BspPI GGATC 3 cut(s) 664, 896, 1272
BspT104I TTCGAA 2 cut(s) 250, 379
BsrI ACTGG 1 cut(s) 605
BssMI GATC 8 cut(s) 82, 656, 694, 901, 1080, 1155, 1252, 1264
Bst2UI CCWGG 2 cut(s) 570, 729
Bst4CI ACNGT 2 cut(s) 49, 1147
BstBI TTCGAA 2 cut(s) 250, 379
BstC8I GCNNGC 5 cut(s) 387, 596, 711, 783, 1137
BstDEI CTNAG 5 cut(s) 133, 341, 506, 586, 850
BstF5I GGATG 6 cut(s) 8, 23, 350, 761, 1096, 1246
BstFNI CGCG 1 cut(s) 324
BstH2I RGCGCY 1 cut(s) 1136
BstHHI GCGC 1 cut(s) 1135
BstKTI GATC 8 cut(s) 85, 659, 697, 904, 1083, 1158, 1255, 1267
BstMBI GATC 8 cut(s) 82, 656, 694, 901, 1080, 1155, 1252, 1264
BstMWI GCNNNNNNNGC 3 cut(s) 591, 629, 782
BstNI CCWGG 2 cut(s) 570, 729
BstNSI RCATGY 4 cut(s) 598, 713, 951, 1062
BstSCI CCNGG 2 cut(s) 568, 727
BstSFI CTRYAG 1 cut(s) 786
BstUI CGCG 1 cut(s) 324
BstV1I GCAGC 3 cut(s) 635, 772, 1025
BstXI CCANNNNNNTGG 1 cut(s) 627
BsuRI GGCC 1 cut(s) 74
BtgZI GCGATG 1 cut(s) 339
BtsCI GGATG 6 cut(s) 8, 23, 350, 761, 1096, 1246
BtsIMutI CAGTG 1 cut(s) 598
BveI ACCTGC 3 cut(s) 623, 671, 779
Cac8I GCNNGC 5 cut(s) 387, 596, 711, 783, 1137
CaiI CAGNNNCTG 1 cut(s) 686
CciI TCATGA 2 cut(s) 298, 898
CfoI GCGC 1 cut(s) 1135
Cfr13I GGNCC 2 cut(s) 211, 876
Csp6I GTAC 1 cut(s) 398
CviQI GTAC 1 cut(s) 398
DdeI CTNAG 5 cut(s) 133, 341, 506, 586, 850
DpnI GATC 8 cut(s) 84, 658, 696, 903, 1082, 1157, 1254, 1266
DpnII GATC 8 cut(s) 82, 656, 694, 901, 1080, 1155, 1252, 1264
EaeI YGGCCR 1 cut(s) 72
Eco47I GGWCC 2 cut(s) 211, 876
EcoO109I RGGNCCY 1 cut(s) 211
EcoRII CCWGG 2 cut(s) 568, 727
EcoT22I ATGCAT 4 cut(s) 458, 715, 1064, 1246
FaqI GGGAC 1 cut(s) 197
FauNDI CATATG 2 cut(s) 391, 832
FbaI TGATCA 2 cut(s) 1080, 1252
Fnu4HI GCNGC 4 cut(s) 75, 624, 786, 1014
FokI GGATG 5 cut(s) 10, 337, 748, 1103, 1253
Fsp4HI GCNGC 4 cut(s) 75, 624, 786, 1014
FspBI CTAG 1 cut(s) 674
GlaI GCGC 1 cut(s) 1134
GluI GCNGC 4 cut(s) 75, 624, 786, 1014
GsuI CTGGAG 1 cut(s) 622
HaeII RGCGCY 1 cut(s) 1136
HaeIII GGCC 1 cut(s) 74
HhaI GCGC 1 cut(s) 1135
Hin6I GCGC 1 cut(s) 1133
HinP1I GCGC 1 cut(s) 1133
HindIII AAGCTT 2 cut(s) 583, 1284
HinfI GANTC 4 cut(s) 5, 407, 437, 537
HphI GGTGA 4 cut(s) 236, 446, 563, 789
Hpy166II GTNNAC 4 cut(s) 398, 441, 725, 879
Hpy188I TCNGA 5 cut(s) 180, 276, 344, 509, 1113
Hpy188III TCNNGA 8 cut(s) 86, 146, 194, 299, 413, 674, 899, 1238
Hpy8I GTNNAC 4 cut(s) 398, 441, 725, 879
HpyAV CCTTC 1 cut(s) 551
HpyCH4III ACNGT 2 cut(s) 49, 1147
HpyCH4IV ACGT 6 cut(s) 244, 559, 967, 991, 1018, 1033
HpyF10VI GCNNNNNNNGC 3 cut(s) 591, 629, 782
HpyF3I CTNAG 5 cut(s) 133, 341, 506, 586, 850
HpySE526I ACGT 6 cut(s) 244, 559, 967, 991, 1018, 1033
HspAI GCGC 1 cut(s) 1133
Ksp22I TGATCA 2 cut(s) 1080, 1252
Kzo9I GATC 8 cut(s) 82, 656, 694, 901, 1080, 1155, 1252, 1264
LmnI GCTCC 5 cut(s) 88, 737, 778, 1114, 1144
Lsp1109I GCAGC 3 cut(s) 635, 772, 1025
LweI GCATC 7 cut(s) 154, 274, 443, 770, 1071, 1159, 1231
MaeI CTAG 1 cut(s) 674
MaeII ACGT 6 cut(s) 244, 559, 967, 991, 1018, 1033
MaeIII GTNAC 1 cut(s) 99
MalI GATC 8 cut(s) 84, 658, 696, 903, 1082, 1157, 1254, 1266
MboI GATC 8 cut(s) 82, 656, 694, 901, 1080, 1155, 1252, 1264
MboII GAAGA 6 cut(s) 27, 167, 170, 566, 974, 1178
MfeI CAATTG 1 cut(s) 999
MlyI GAGTC 2 cut(s) 446, 531
MmeI TCCRAC 2 cut(s) 158, 759
MnlI CCTC 8 cut(s) 37, 140, 176, 202, 597, 810, 915, 1081
Mph1103I ATGCAT 4 cut(s) 458, 715, 1064, 1246
MseI TTAA 5 cut(s) 425, 819, 1005, 1125, 1179
MslI CAYNNNNRTG 3 cut(s) 549, 802, 1067
MspA1I CMGCKG 2 cut(s) 371, 404
MspR9I CCNGG 2 cut(s) 570, 729
MunI CAATTG 1 cut(s) 999
Mva1269I GAATGC 1 cut(s) 387
MvaI CCWGG 2 cut(s) 570, 729
MvnI CGCG 1 cut(s) 324
MwoI GCNNNNNNNGC 3 cut(s) 591, 629, 782
NdeI CATATG 2 cut(s) 391, 832
NdeII GATC 8 cut(s) 82, 656, 694, 901, 1080, 1155, 1252, 1264
NlaIV GGNNCC 3 cut(s) 46, 213, 733
NsiI ATGCAT 4 cut(s) 458, 715, 1064, 1246
NspI RCATGY 4 cut(s) 598, 713, 951, 1062
NspV TTCGAA 2 cut(s) 250, 379
PaeI GCATGC 2 cut(s) 598, 713
PagI TCATGA 2 cut(s) 298, 898
PaqCI CACCTGC 2 cut(s) 623, 671
PctI GAATGC 1 cut(s) 387
PfeI GAWTC 2 cut(s) 5, 407
PfoI TCCNGGA 1 cut(s) 568
PkrI GCNGC 4 cut(s) 76, 625, 787, 1015
PleI GAGTC 2 cut(s) 445, 531
PpsI GAGTC 2 cut(s) 445, 531
PpuMI RGGWCCY 1 cut(s) 211
Psp5II RGGWCCY 1 cut(s) 211
Psp6I CCWGG 2 cut(s) 568, 727
PspGI CCWGG 2 cut(s) 568, 727
PspN4I GGNNCC 3 cut(s) 46, 213, 733
PspPI GGNCC 2 cut(s) 211, 876
PspPPI RGGWCCY 1 cut(s) 211
PstI CTGCAG 1 cut(s) 790
PstNI CAGNNNCTG 1 cut(s) 686
PvuII CAGCTG 2 cut(s) 371, 404
RsaI GTAC 1 cut(s) 399
RsaNI GTAC 1 cut(s) 398
RseI CAYNNNNRTG 3 cut(s) 549, 802, 1067
SaqAI TTAA 5 cut(s) 425, 819, 1005, 1125, 1179
SatI GCNGC 4 cut(s) 75, 624, 786, 1014
Sau3AI GATC 8 cut(s) 82, 656, 694, 901, 1080, 1155, 1252, 1264
Sau96I GGNCC 2 cut(s) 211, 876
SchI GAGTC 2 cut(s) 446, 531
ScrFI CCNGG 2 cut(s) 570, 729
SfaNI GCATC 7 cut(s) 154, 274, 443, 770, 1071, 1159, 1231
SfcI CTRYAG 1 cut(s) 786
SfuI TTCGAA 2 cut(s) 250, 379
SinI GGWCC 2 cut(s) 211, 876
SmiMI CAYNNNNRTG 3 cut(s) 549, 802, 1067
SmlI CTYRAG 1 cut(s) 906
SmoI CTYRAG 1 cut(s) 906
SphI GCATGC 2 cut(s) 598, 713
SsiI CCGC 4 cut(s) 75, 206, 287, 776
SspI AATATT 1 cut(s) 489
SspMI CTAG 1 cut(s) 674
StyD4I CCNGG 2 cut(s) 568, 727
TaaI ACNGT 2 cut(s) 49, 1147
TaiI ACGT 6 cut(s) 247, 562, 970, 994, 1021, 1036
TaqI TCGA 5 cut(s) 147, 250, 379, 414, 1195
TauI GCSGC 1 cut(s) 77
TfiI GAWTC 2 cut(s) 5, 407
Tru1I TTAA 5 cut(s) 425, 819, 1005, 1125, 1179
Tru9I TTAA 5 cut(s) 425, 819, 1005, 1125, 1179
TscAI CASTG 1 cut(s) 605
TseI GCWGC 3 cut(s) 623, 785, 1013
TspDTI ATGAA 7 cut(s) 168, 329, 432, 473, 533, 887, 1179
TspRI CASTG 1 cut(s) 605
VpaK11BI GGWCC 2 cut(s) 211, 876
XapI RAATTY 2 cut(s) 233, 1121
XbaI TCTAGA 1 cut(s) 673
XceI RCATGY 4 cut(s) 598, 713, 951, 1062
XspI CTAG 1 cut(s) 674
Zsp2I ATGCAT 4 cut(s) 458, 715, 1064, 1246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.