Rmu_sc0001240.1_g000015

Ribosomal protein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001240.1
OG0014879
Physical Location & Seq
Forward (+)
67305 .. 67781
477 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001240.1_g000015.1.cds

Sequence Viewer

Length: 477 bp
atggcttcatttgatgaggagcaagatttattgcttcgcatgtatgcgaataataatcacctcttggcagagttggatgacaatgaggacgacgaggccgaatcgaggcgtagaggagcagttcctggccatatagttattaatcgtccccgacaagaagctggatataatctatacatggactactttgctgaggttccgcgattcggagaagcaaaatttcgtagacgatttcgaatgagcaaaagtttatttcatcaaattgcggaagccgtcaaagatcacgacaatttctttgtgcaacaacgcgatggtattggtaagctcggattatcatctttgcaaaaatttacagctgtttttcgaatgcttgcatatggtgtaccagctgatgctcttgatgaatatttaaaaattggtgagtctactgcaattcgatgtatgaaaaggttttgtcgacctgttatagaggtctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Plant_tran

Protein Analysis

158

Amino Acids

18.33

Weight (kDa)

6.1

Isoelectric Point (pI)

61.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 3 cut(s) 226, 425, 457
AccII CGCG 2 cut(s) 202, 309
AciI CCGC 2 cut(s) 200, 266
AcoI YGGCCR 1 cut(s) 127
AcsI RAATTY 2 cut(s) 218, 347
AfaI GTAC 1 cut(s) 384
AfiI CCNNNNNNNGG 2 cut(s) 105, 206
AjnI CCWGG 1 cut(s) 124
AluBI AGCT 4 cut(s) 161, 325, 356, 389
AluI AGCT 4 cut(s) 161, 325, 356, 389
AlwNI CAGNNNCTG 1 cut(s) 125
AoxI GGCC 2 cut(s) 96, 127
ApoI RAATTY 2 cut(s) 218, 347
ArsI GACNNNNNNTTYG 2 cut(s) 278, 310
AseI ATTAAT 1 cut(s) 141
AsuHPI GGTGA 2 cut(s) 50, 431
AsuII TTCGAA 2 cut(s) 235, 364
BalI TGGCCA 1 cut(s) 129
BbvCI CCTCAGC 1 cut(s) 192
BccI CCATC 1 cut(s) 305
BceAI ACGGC 1 cut(s) 257
BciT130I CCWGG 1 cut(s) 126
BfaI CTAG 1 cut(s) 475
Bme1390I CCNGG 1 cut(s) 126
BmiI GGNNCC 1 cut(s) 198
BmrFI CCNGG 1 cut(s) 126
BmsI GCATC 1 cut(s) 382
Bpu10I CCTNAGC 1 cut(s) 192
Bpu14I TTCGAA 2 cut(s) 235, 364
BsaBI GATNNNNATC 1 cut(s) 334
Bsc4I CCNNNNNNNGG 2 cut(s) 105, 206
Bse8I GATNNNNATC 1 cut(s) 334
BseBI CCWGG 1 cut(s) 126
BseGI GGATG 1 cut(s) 82
BseJI GATNNNNATC 1 cut(s) 334
BseLI CCNNNNNNNGG 2 cut(s) 105, 206
BseMII CTCAG 1 cut(s) 183
BseRI GAGGAG 2 cut(s) 32, 129
Bsh1236I CGCG 2 cut(s) 202, 309
BshFI GGCC 2 cut(s) 98, 129
BslFI GGGAC 1 cut(s) 132
BslI CCNNNNNNNGG 2 cut(s) 105, 206
BsmFI GGGAC 1 cut(s) 132
BsmI GAATGC 1 cut(s) 372
BsnI GGCC 2 cut(s) 98, 129
Bsp119I TTCGAA 2 cut(s) 235, 364
Bsp143I GATC 1 cut(s) 280
BspACI CCGC 2 cut(s) 200, 266
BspANI GGCC 2 cut(s) 98, 129
BspCNI CTCAG 1 cut(s) 184
BspFNI CGCG 2 cut(s) 202, 309
BspLI GGNNCC 1 cut(s) 198
BspT104I TTCGAA 2 cut(s) 235, 364
BssMI GATC 1 cut(s) 280
Bst2UI CCWGG 1 cut(s) 126
BstBI TTCGAA 2 cut(s) 235, 364
BstC8I GCNNGC 1 cut(s) 372
BstDEI CTNAG 1 cut(s) 192
BstF5I GGATG 1 cut(s) 82
BstFNI CGCG 2 cut(s) 202, 309
BstKTI GATC 1 cut(s) 283
BstMBI GATC 1 cut(s) 280
BstNI CCWGG 1 cut(s) 126
BstNSI RCATGY 1 cut(s) 43
BstSCI CCNGG 1 cut(s) 124
BstUI CGCG 2 cut(s) 202, 309
BsuRI GGCC 2 cut(s) 98, 129
BtgZI GCGATG 1 cut(s) 324
BtsCI GGATG 1 cut(s) 82
Cac8I GCNNGC 1 cut(s) 372
CaiI CAGNNNCTG 1 cut(s) 125
Csp6I GTAC 1 cut(s) 383
CviAII CATG 2 cut(s) 40, 178
CviJI RGCY 8 cut(s) 5, 98, 129, 161, 272, 325, 356, 389
CviKI_1 RGCY 8 cut(s) 5, 98, 129, 161, 272, 325, 356, 389
CviQI GTAC 1 cut(s) 383
DdeI CTNAG 1 cut(s) 192
DpnI GATC 1 cut(s) 282
DpnII GATC 1 cut(s) 280
DraI TTTAAA 1 cut(s) 411
EaeI YGGCCR 1 cut(s) 127
EcoRII CCWGG 1 cut(s) 124
FaeI CATG 2 cut(s) 43, 181
FaqI GGGAC 1 cut(s) 132
FatI CATG 2 cut(s) 39, 177
FauNDI CATATG 1 cut(s) 376
FblI GTMKAC 3 cut(s) 226, 425, 457
FokI GGATG 1 cut(s) 89
FspBI CTAG 1 cut(s) 475
HaeIII GGCC 2 cut(s) 98, 129
Hin1II CATG 2 cut(s) 43, 181
HincII GTYRAC 1 cut(s) 458
HindII GTYRAC 1 cut(s) 458
HinfI GANTC 3 cut(s) 101, 204, 422
HphI GGTGA 2 cut(s) 50, 431
Hpy166II GTNNAC 4 cut(s) 227, 383, 426, 458
Hpy188I TCNGA 2 cut(s) 209, 329
Hpy188III TCNNGA 2 cut(s) 284, 398
Hpy8I GTNNAC 4 cut(s) 227, 383, 426, 458
Hpy99I CGWCG 1 cut(s) 95
HpyCH4V TGCA 4 cut(s) 301, 343, 374, 431
HpyF3I CTNAG 1 cut(s) 192
Hsp92II CATG 2 cut(s) 43, 181
Kzo9I GATC 1 cut(s) 280
LmnI GCTCC 2 cut(s) 19, 116
LpnPI CCDG 4 cut(s) 111, 138, 147, 399
LweI GCATC 1 cut(s) 382
MaeI CTAG 1 cut(s) 475
MalI GATC 1 cut(s) 282
MboI GATC 1 cut(s) 280
MlsI TGGCCA 1 cut(s) 129
MluCI AATT 6 cut(s) 218, 261, 289, 347, 414, 432
MluNI TGGCCA 1 cut(s) 129
MlyI GAGTC 1 cut(s) 431
MmeI TCCRAC 1 cut(s) 54
MnlI CCTC 8 cut(s) 10, 71, 79, 88, 99, 107, 187, 463
Mox20I TGGCCA 1 cut(s) 129
MscI TGGCCA 1 cut(s) 129
MseI TTAA 2 cut(s) 141, 410
Msp20I TGGCCA 1 cut(s) 129
MspA1I CMGCKG 2 cut(s) 356, 389
MspR9I CCNGG 1 cut(s) 126
Mva1269I GAATGC 1 cut(s) 372
MvaI CCWGG 1 cut(s) 126
MvnI CGCG 2 cut(s) 202, 309
NdeI CATATG 1 cut(s) 376
NdeII GATC 1 cut(s) 280
NlaIII CATG 2 cut(s) 43, 181
NlaIV GGNNCC 1 cut(s) 198
NspI RCATGY 1 cut(s) 43
NspV TTCGAA 2 cut(s) 235, 364
PcsI WCGNNNNNNNCGW 1 cut(s) 96
PctI GAATGC 1 cut(s) 372
PfeI GAWTC 2 cut(s) 101, 204
PleI GAGTC 1 cut(s) 430
PpsI GAGTC 1 cut(s) 430
PshBI ATTAAT 1 cut(s) 141
Psp6I CCWGG 1 cut(s) 124
PspGI CCWGG 1 cut(s) 124
PspN4I GGNNCC 1 cut(s) 198
PstNI CAGNNNCTG 1 cut(s) 125
PvuII CAGCTG 2 cut(s) 356, 389
RsaI GTAC 1 cut(s) 384
RsaNI GTAC 1 cut(s) 383
SalI GTCGAC 1 cut(s) 456
SaqAI TTAA 2 cut(s) 141, 410
Sau3AI GATC 1 cut(s) 280
SchI GAGTC 1 cut(s) 431
ScrFI CCNGG 1 cut(s) 126
SetI ASST 9 cut(s) 63, 163, 198, 327, 358, 391, 452, 463, 474
SfaNI GCATC 1 cut(s) 382
SfuI TTCGAA 2 cut(s) 235, 364
Sse9I AATT 6 cut(s) 218, 261, 289, 347, 414, 432
SsiI CCGC 2 cut(s) 200, 266
SspI AATATT 1 cut(s) 407
SspMI CTAG 1 cut(s) 475
StyD4I CCNGG 1 cut(s) 124
TaqI TCGA 5 cut(s) 104, 235, 364, 436, 457
TasI AATT 6 cut(s) 218, 261, 289, 347, 414, 432
TfiI GAWTC 2 cut(s) 101, 204
Tru1I TTAA 2 cut(s) 141, 410
Tru9I TTAA 2 cut(s) 141, 410
TspDTI ATGAA 3 cut(s) 245, 417, 458
VspI ATTAAT 1 cut(s) 141
XapI RAATTY 2 cut(s) 218, 347
XceI RCATGY 1 cut(s) 43
XmiI GTMKAC 3 cut(s) 226, 425, 457
XspI CTAG 1 cut(s) 475
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.