Rmu_sc0014826.1_g000003

Ribosomal protein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014826.1
OG0014879
Physical Location & Seq
Reverse (-)
4845 .. 5495
651 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014826.1_g000003.1.cds

Sequence Viewer

Length: 651 bp
atgcgaataataatcacctcttgggcagagttggatgacaatgaggacgacgaggccgaatctaggcgtagaggagcagttcctggccatatagttattaatcgtcctcgacaagaagctagatataatctatacatggactactttgctgaggttccgcgattcggagaagcaaaatttcgcagacgatttcgaatgagcaaaagtttatttcatcaaattgctgaagccgtcaaagatcacgacaatttctttgtgcaacaacgcgatggtattggtaagctcggattatcatctttgcaaaaatttacagctgtttttcgaatgcttgcatatggtgtaccagctgatgctcttgatgaatatttaaaaattggtgagtctactgcaattcgatgtatgaaaaggttttgtcgacctgttatagaggtctttggaaaccgctatctaagaacacctaatgtcgaggatgttgcgagacttttgtatataggtgaagaacgtgggttcccaggaatgttagggagcttagattgcatgcattggcgttggaaaaattgtcctacagcttgggcaggaatgtatgcagggcgtagtagatcaccaactattatcctcgaggcagtagttgattatgatctttggatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Plant_tran

Protein Analysis

216

Amino Acids

25.13

Weight (kDa)

8.67

Isoelectric Point (pI)

60.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 617
AccI GTMKAC 2 cut(s) 383, 415
AccII CGCG 2 cut(s) 160, 267
AciI CCGC 2 cut(s) 158, 442
AcoI YGGCCR 1 cut(s) 85
AcsI RAATTY 2 cut(s) 176, 305
AcuI CTGAAG 1 cut(s) 246
AfaI GTAC 1 cut(s) 342
AfiI CCNNNNNNNGG 2 cut(s) 63, 164
AjnI CCWGG 2 cut(s) 82, 511
AloI GAACNNNNNNTCC 2 cut(s) 492, 524
AluBI AGCT 6 cut(s) 119, 283, 314, 347, 528, 569
AluI AGCT 6 cut(s) 119, 283, 314, 347, 528, 569
Alw26I GTCTC 1 cut(s) 472
AlwNI CAGNNNCTG 1 cut(s) 83
Ama87I CYCGRG 1 cut(s) 617
AoxI GGCC 2 cut(s) 54, 85
ApoI RAATTY 2 cut(s) 176, 305
ArsI GACNNNNNNTTYG 2 cut(s) 236, 268
AseI ATTAAT 1 cut(s) 99
AsuHPI GGTGA 4 cut(s) 7, 389, 506, 594
AsuII TTCGAA 2 cut(s) 193, 322
AvaI CYCGRG 1 cut(s) 617
BalI TGGCCA 1 cut(s) 87
BbvCI CCTCAGC 1 cut(s) 150
BccI CCATC 1 cut(s) 263
BceAI ACGGC 1 cut(s) 215
BcgI CGANNNNNNTGC 2 cut(s) 455, 489
BciT130I CCWGG 2 cut(s) 84, 513
BcoDI GTCTC 1 cut(s) 472
BfaI CTAG 3 cut(s) 63, 120, 649
BfmI CTRYAG 1 cut(s) 564
Bme1390I CCNGG 2 cut(s) 84, 513
BmeT110I CYCGRG 1 cut(s) 617
BmiI GGNNCC 2 cut(s) 156, 509
BmrFI CCNGG 2 cut(s) 84, 513
BmsI GCATC 1 cut(s) 340
Bpu10I CCTNAGC 1 cut(s) 150
Bpu14I TTCGAA 2 cut(s) 193, 322
BsaBI GATNNNNATC 2 cut(s) 292, 636
BsaJI CCNNGG 1 cut(s) 511
Bsc4I CCNNNNNNNGG 2 cut(s) 63, 164
Bse8I GATNNNNATC 2 cut(s) 292, 636
BseBI CCWGG 2 cut(s) 84, 513
BseDI CCNNGG 1 cut(s) 511
BseGI GGATG 2 cut(s) 40, 475
BseJI GATNNNNATC 2 cut(s) 292, 636
BseLI CCNNNNNNNGG 2 cut(s) 63, 164
BseMII CTCAG 1 cut(s) 141
BseRI GAGGAG 1 cut(s) 87
Bsh1236I CGCG 2 cut(s) 160, 267
BshFI GGCC 2 cut(s) 56, 87
BsiHKCI CYCGRG 1 cut(s) 617
BslI CCNNNNNNNGG 2 cut(s) 63, 164
BsmAI GTCTC 1 cut(s) 472
BsmI GAATGC 1 cut(s) 330
BsnI GGCC 2 cut(s) 56, 87
BsoBI CYCGRG 1 cut(s) 617
Bsp119I TTCGAA 2 cut(s) 193, 322
Bsp143I GATC 4 cut(s) 238, 599, 637, 645
BspACI CCGC 2 cut(s) 158, 442
BspANI GGCC 2 cut(s) 56, 87
BspCNI CTCAG 1 cut(s) 142
BspFNI CGCG 2 cut(s) 160, 267
BspLI GGNNCC 2 cut(s) 156, 509
BspT104I TTCGAA 2 cut(s) 193, 322
BssECI CCNNGG 1 cut(s) 511
BssMI GATC 4 cut(s) 238, 599, 637, 645
Bst2UI CCWGG 2 cut(s) 84, 513
BstBI TTCGAA 2 cut(s) 193, 322
BstC8I GCNNGC 2 cut(s) 330, 539
BstDEI CTNAG 3 cut(s) 150, 449, 529
BstF5I GGATG 2 cut(s) 40, 475
BstFNI CGCG 2 cut(s) 160, 267
BstKTI GATC 4 cut(s) 241, 602, 640, 648
BstMAI GTCTC 1 cut(s) 472
BstMBI GATC 4 cut(s) 238, 599, 637, 645
BstMWI GCNNNNNNNGC 1 cut(s) 534
BstNI CCWGG 2 cut(s) 84, 513
BstNSI RCATGY 1 cut(s) 541
BstSCI CCNGG 2 cut(s) 82, 511
BstSFI CTRYAG 1 cut(s) 564
BstUI CGCG 2 cut(s) 160, 267
BstX2I RGATCY 1 cut(s) 645
BstYI RGATCY 1 cut(s) 645
BsuRI GGCC 2 cut(s) 56, 87
BtgZI GCGATG 1 cut(s) 282
BtsCI GGATG 2 cut(s) 40, 475
Cac8I GCNNGC 2 cut(s) 330, 539
CaiI CAGNNNCTG 1 cut(s) 83
Csp6I GTAC 1 cut(s) 341
CviAII CATG 2 cut(s) 136, 538
CviJI RGCY 9 cut(s) 56, 87, 119, 230, 283, 314, 347, 528, 569
CviKI_1 RGCY 9 cut(s) 56, 87, 119, 230, 283, 314, 347, 528, 569
CviQI GTAC 1 cut(s) 341
DdeI CTNAG 3 cut(s) 150, 449, 529
DpnI GATC 4 cut(s) 240, 601, 639, 647
DpnII GATC 4 cut(s) 238, 599, 637, 645
DraI TTTAAA 1 cut(s) 369
EaeI YGGCCR 1 cut(s) 85
Eco57I CTGAAG 1 cut(s) 246
Eco88I CYCGRG 1 cut(s) 617
EcoRII CCWGG 2 cut(s) 82, 511
EcoT22I ATGCAT 1 cut(s) 543
FaeI CATG 2 cut(s) 139, 541
FatI CATG 2 cut(s) 135, 537
FauNDI CATATG 1 cut(s) 334
FblI GTMKAC 2 cut(s) 383, 415
FokI GGATG 2 cut(s) 47, 482
FspBI CTAG 3 cut(s) 63, 120, 649
HaeIII GGCC 2 cut(s) 56, 87
Hin1II CATG 2 cut(s) 139, 541
HincII GTYRAC 1 cut(s) 416
HindII GTYRAC 1 cut(s) 416
HinfI GANTC 3 cut(s) 59, 162, 380
HphI GGTGA 4 cut(s) 7, 389, 506, 594
Hpy166II GTNNAC 3 cut(s) 341, 384, 416
Hpy188I TCNGA 2 cut(s) 167, 287
Hpy188III TCNNGA 2 cut(s) 242, 356
Hpy8I GTNNAC 3 cut(s) 341, 384, 416
Hpy99I CGWCG 1 cut(s) 53
HpyCH4IV ACGT 1 cut(s) 502
HpyCH4V TGCA 7 cut(s) 259, 301, 332, 389, 537, 541, 587
HpyF10VI GCNNNNNNNGC 1 cut(s) 534
HpyF3I CTNAG 3 cut(s) 150, 449, 529
HpySE526I ACGT 1 cut(s) 502
Hsp92II CATG 2 cut(s) 139, 541
Kzo9I GATC 4 cut(s) 238, 599, 637, 645
LmnI GCTCC 2 cut(s) 74, 525
LpnPI CCDG 8 cut(s) 69, 96, 357, 432, 498, 525, 561, 573
LweI GCATC 1 cut(s) 340
MaeI CTAG 3 cut(s) 63, 120, 649
MaeII ACGT 1 cut(s) 502
MalI GATC 4 cut(s) 240, 601, 639, 647
MboI GATC 4 cut(s) 238, 599, 637, 645
MboII GAAGA 1 cut(s) 509
MflI RGATCY 1 cut(s) 645
MlsI TGGCCA 1 cut(s) 87
MluCI AATT 7 cut(s) 176, 219, 247, 305, 372, 390, 556
MluNI TGGCCA 1 cut(s) 87
MlyI GAGTC 1 cut(s) 389
MmeI TCCRAC 2 cut(s) 12, 530
Mox20I TGGCCA 1 cut(s) 87
Mph1103I ATGCAT 1 cut(s) 543
MscI TGGCCA 1 cut(s) 87
MseI TTAA 2 cut(s) 99, 368
Msp20I TGGCCA 1 cut(s) 87
MspA1I CMGCKG 2 cut(s) 314, 347
MspR9I CCNGG 2 cut(s) 84, 513
Mva1269I GAATGC 1 cut(s) 330
MvaI CCWGG 2 cut(s) 84, 513
MvnI CGCG 2 cut(s) 160, 267
MwoI GCNNNNNNNGC 1 cut(s) 534
NdeI CATATG 1 cut(s) 334
NdeII GATC 4 cut(s) 238, 599, 637, 645
NlaIII CATG 2 cut(s) 139, 541
NlaIV GGNNCC 2 cut(s) 156, 509
NsiI ATGCAT 1 cut(s) 543
NspI RCATGY 1 cut(s) 541
NspV TTCGAA 2 cut(s) 193, 322
PaeI GCATGC 1 cut(s) 541
PaeR7I CTCGAG 1 cut(s) 617
PcsI WCGNNNNNNNCGW 1 cut(s) 54
PctI GAATGC 1 cut(s) 330
PfeI GAWTC 2 cut(s) 59, 162
PleI GAGTC 1 cut(s) 388
PpsI GAGTC 1 cut(s) 388
PshBI ATTAAT 1 cut(s) 99
Psp6I CCWGG 2 cut(s) 82, 511
PspGI CCWGG 2 cut(s) 82, 511
PspN4I GGNNCC 2 cut(s) 156, 509
PspXI VCTCGAGB 1 cut(s) 617
PstNI CAGNNNCTG 1 cut(s) 83
PsuI RGATCY 1 cut(s) 645
PvuII CAGCTG 2 cut(s) 314, 347
RsaI GTAC 1 cut(s) 342
RsaNI GTAC 1 cut(s) 341
SalI GTCGAC 1 cut(s) 414
SaqAI TTAA 2 cut(s) 99, 368
Sau3AI GATC 4 cut(s) 238, 599, 637, 645
SchI GAGTC 1 cut(s) 389
ScrFI CCNGG 2 cut(s) 84, 513
SfaNI GCATC 1 cut(s) 340
SfcI CTRYAG 1 cut(s) 564
Sfr274I CTCGAG 1 cut(s) 617
SfuI TTCGAA 2 cut(s) 193, 322
SlaI CTCGAG 1 cut(s) 617
SmlI CTYRAG 1 cut(s) 617
SmoI CTYRAG 1 cut(s) 617
SphI GCATGC 1 cut(s) 541
Sse9I AATT 7 cut(s) 176, 219, 247, 305, 372, 390, 556
SsiI CCGC 2 cut(s) 158, 442
SspI AATATT 1 cut(s) 365
SspMI CTAG 3 cut(s) 63, 120, 649
StyD4I CCNGG 2 cut(s) 82, 511
TaiI ACGT 1 cut(s) 505
TaqI TCGA 7 cut(s) 109, 193, 322, 394, 415, 465, 618
TasI AATT 7 cut(s) 176, 219, 247, 305, 372, 390, 556
TfiI GAWTC 2 cut(s) 59, 162
Tru1I TTAA 2 cut(s) 99, 368
Tru9I TTAA 2 cut(s) 99, 368
TspDTI ATGAA 3 cut(s) 203, 375, 416
VspI ATTAAT 1 cut(s) 99
XapI RAATTY 2 cut(s) 176, 305
XceI RCATGY 1 cut(s) 541
XhoI CTCGAG 1 cut(s) 617
XmiI GTMKAC 2 cut(s) 383, 415
XspI CTAG 3 cut(s) 63, 120, 649
Zsp2I ATGCAT 1 cut(s) 543
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.