Rmu_sc0010547.1_g000011

Ribosomal protein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010547.1
OG0014879
Physical Location & Seq
Reverse (-)
24077 .. 26715
2639 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010547.1_g000011.1.cds

Sequence Viewer

Length: 1113 bp
atggcttcatttgatgaggagcaagatttattgcttcgcatgtatgcgaataataatcacctcttggcagagttggatgacaatgaggacgacgaggccgaatcgaggcgtagaggagcagttcctggccatatagttattaatccagaagcaaaatttcgcagaagatttcaaatgagcaaaagtttatttcatcaaattgcggaagccgtcaaagatcacgacaatttctttgtgcaacaacgcgatggtattggtaagctcaaattatcatctttgcaaaaatttacagctgtttttcgaatgcttgcatatggtgtaccagctgatgctcttgatgaatatttaaaaattggtgagtctactgcaattcgatgtatgaaaaggttttgtcgagctattatagaggtctttggaaaccgctatctaagaacacctaacgccgaggatgttgcgagacttttgtatataggtgaagaacgtgggttcccaggaatgttagggagcttagattgcatgcattggcgttggaaaaattatcctacagcttgggcaggaatgtatgcagagcatagtagatcaccaactattatcctcgaggcagtagctgattatgatctttggatctggcatgcacattttggtttaccaggctccaacaacgacatcaatgtgcttgaagcatctcacctatttgcaaatcttgtggaaggtaaatctactcccgttaattataagattctagaaaaagattatgacaccggttattatttagccaatggtatatatcctaagtggtctacactagtgaaaactattcatgatcctcaaggtccaaaaaaagtattgtttgccaaaaaacaagagtcgtgtcggaaggatgttgaacgagcatttggagttcttcaatcacatgaagacgaacaagagctgtttagtgatgaacttgcctcacctcatcggcccattggtgtaaagaaagcaaagctgaaagggaaagagttgaatgagaagactaagattgctcaacaagtgaaagaatccaaccaagagctgaaggagttacttgaaaaaagcttgttggagagaaaagctttttcctctaagcattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Plant_tran

Protein Analysis

370

Amino Acids

42.49

Weight (kDa)

6.91

Isoelectric Point (pI)

48.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 735
AbsI CCTCGAGG 1 cut(s) 596
AccI GTMKAC 2 cut(s) 362, 800
AccII CGCG 1 cut(s) 246
AciI CCGC 2 cut(s) 203, 421
AclWI GGATC 2 cut(s) 632, 818
AcoI YGGCCR 1 cut(s) 127
AcsI RAATTY 2 cut(s) 155, 284
AcuI CTGAAG 1 cut(s) 1076
AfaI GTAC 1 cut(s) 321
AfiI CCNNNNNNNGG 1 cut(s) 105
AgeI ACCGGT 1 cut(s) 761
AgsI TTSAA 6 cut(s) 173, 680, 887, 908, 1006, 1070
AhlI ACTAGT 1 cut(s) 805
AjnI CCWGG 3 cut(s) 124, 490, 649
AjuI GAANNNNNNNTTGG 2 cut(s) 879, 911
AloI GAACNNNNNNTCC 2 cut(s) 471, 503
Alw26I GTCTC 1 cut(s) 451
AlwI GGATC 2 cut(s) 632, 818
AlwNI CAGNNNCTG 2 cut(s) 125, 608
Ama87I CYCGRG 1 cut(s) 596
AoxI GGCC 3 cut(s) 96, 127, 962
ApoI RAATTY 2 cut(s) 155, 284
ArsI GACNNNNNNTTYG 2 cut(s) 215, 247
AseI ATTAAT 1 cut(s) 141
AsiGI ACCGGT 1 cut(s) 761
AspS9I GGNCC 2 cut(s) 833, 963
AsuHPI GGTGA 6 cut(s) 50, 368, 485, 573, 680, 945
AsuII TTCGAA 1 cut(s) 301
AvaI CYCGRG 1 cut(s) 596
AvaII GGWCC 1 cut(s) 833
BalI TGGCCA 1 cut(s) 129
BbsI GAAGAC 2 cut(s) 924, 1019
BccI CCATC 1 cut(s) 242
BceAI ACGGC 1 cut(s) 194
BcgI CGANNNNNNTGC 2 cut(s) 434, 468
BciT130I CCWGG 3 cut(s) 126, 492, 651
BcoDI GTCTC 1 cut(s) 451
BcuI ACTAGT 1 cut(s) 805
BfaI CTAG 2 cut(s) 743, 806
BfmI CTRYAG 1 cut(s) 543
Bme1390I CCNGG 3 cut(s) 126, 492, 651
Bme18I GGWCC 1 cut(s) 833
BmeT110I CYCGRG 1 cut(s) 596
BmgT120I GGNCC 2 cut(s) 833, 963
BmiI GGNNCC 2 cut(s) 488, 655
BmrFI CCNGG 3 cut(s) 126, 492, 651
BmsI GCATC 2 cut(s) 319, 692
BpiI GAAGAC 2 cut(s) 924, 1019
Bpu14I TTCGAA 1 cut(s) 301
BpuEI CTTGAG 1 cut(s) 813
BsaBI GATNNNNATC 1 cut(s) 615
BsaJI CCNNGG 2 cut(s) 444, 490
BsaWI WCCGGW 1 cut(s) 761
Bsc4I CCNNNNNNNGG 1 cut(s) 105
Bse118I RCCGGY 1 cut(s) 761
Bse8I GATNNNNATC 1 cut(s) 615
BseBI CCWGG 3 cut(s) 126, 492, 651
BseDI CCNNGG 2 cut(s) 444, 490
BseGI GGATG 3 cut(s) 82, 454, 886
BseJI GATNNNNATC 1 cut(s) 615
BseLI CCNNNNNNNGG 1 cut(s) 105
BseRI GAGGAG 2 cut(s) 32, 129
Bsh1236I CGCG 1 cut(s) 246
BshFI GGCC 3 cut(s) 98, 129, 964
BshTI ACCGGT 1 cut(s) 761
BsiHKCI CYCGRG 1 cut(s) 596
BsiSI CCGG 1 cut(s) 762
BslI CCNNNNNNNGG 1 cut(s) 105
BsmAI GTCTC 1 cut(s) 451
BsmI GAATGC 1 cut(s) 309
BsnI GGCC 3 cut(s) 98, 129, 964
BsoBI CYCGRG 1 cut(s) 596
Bsp119I TTCGAA 1 cut(s) 301
Bsp143I GATC 5 cut(s) 217, 578, 616, 624, 823
BspACI CCGC 2 cut(s) 203, 421
BspANI GGCC 3 cut(s) 98, 129, 964
BspFNI CGCG 1 cut(s) 246
BspHI TCATGA 1 cut(s) 820
BspLI GGNNCC 2 cut(s) 488, 655
BspPI GGATC 2 cut(s) 632, 818
BspT104I TTCGAA 1 cut(s) 301
BsrFI RCCGGY 1 cut(s) 761
BssAI RCCGGY 1 cut(s) 761
BssECI CCNNGG 2 cut(s) 444, 490
BssMI GATC 5 cut(s) 217, 578, 616, 624, 823
Bst2UI CCWGG 3 cut(s) 126, 492, 651
BstBI TTCGAA 1 cut(s) 301
BstC8I GCNNGC 3 cut(s) 309, 518, 633
BstDEI CTNAG 5 cut(s) 428, 508, 792, 1017, 1104
BstF5I GGATG 3 cut(s) 82, 454, 886
BstFNI CGCG 1 cut(s) 246
BstKTI GATC 5 cut(s) 220, 581, 619, 627, 826
BstMAI GTCTC 1 cut(s) 451
BstMBI GATC 5 cut(s) 217, 578, 616, 624, 823
BstMWI GCNNNNNNNGC 1 cut(s) 513
BstNI CCWGG 3 cut(s) 126, 492, 651
BstNSI RCATGY 3 cut(s) 43, 520, 635
BstSCI CCNGG 3 cut(s) 124, 490, 649
BstSFI CTRYAG 1 cut(s) 543
BstUI CGCG 1 cut(s) 246
BstV2I GAAGAC 2 cut(s) 924, 1019
BstX2I RGATCY 1 cut(s) 624
BstYI RGATCY 1 cut(s) 624
BsuRI GGCC 3 cut(s) 98, 129, 964
BtgZI GCGATG 1 cut(s) 261
BtsCI GGATG 3 cut(s) 82, 454, 886
Cac8I GCNNGC 3 cut(s) 309, 518, 633
CaiI CAGNNNCTG 2 cut(s) 125, 608
CciI TCATGA 1 cut(s) 820
Cfr10I RCCGGY 1 cut(s) 761
Cfr13I GGNCC 2 cut(s) 833, 963
Csp6I GTAC 1 cut(s) 320
CspAI ACCGGT 1 cut(s) 761
CspCI CAANNNNNGTGG 2 cut(s) 687, 722
CviAII CATG 5 cut(s) 40, 517, 632, 821, 914
CviQI GTAC 1 cut(s) 320
DdeI CTNAG 5 cut(s) 428, 508, 792, 1017, 1104
DpnI GATC 5 cut(s) 219, 580, 618, 626, 825
DpnII GATC 5 cut(s) 217, 578, 616, 624, 823
DraI TTTAAA 1 cut(s) 348
EaeI YGGCCR 1 cut(s) 127
Eco47I GGWCC 1 cut(s) 833
Eco57I CTGAAG 1 cut(s) 1076
Eco88I CYCGRG 1 cut(s) 596
EcoRII CCWGG 3 cut(s) 124, 490, 649
EcoT22I ATGCAT 1 cut(s) 522
FaeI CATG 5 cut(s) 43, 520, 635, 824, 917
FatI CATG 5 cut(s) 39, 516, 631, 820, 913
FauNDI CATATG 1 cut(s) 313
FblI GTMKAC 2 cut(s) 362, 800
FokI GGATG 3 cut(s) 89, 461, 893
FspBI CTAG 2 cut(s) 743, 806
HaeIII GGCC 3 cut(s) 98, 129, 964
HapII CCGG 1 cut(s) 762
Hin1II CATG 5 cut(s) 43, 520, 635, 824, 917
HindIII AAGCTT 2 cut(s) 1075, 1092
HinfI GANTC 5 cut(s) 101, 359, 739, 866, 1040
HpaII CCGG 1 cut(s) 762
HphI GGTGA 6 cut(s) 50, 368, 485, 573, 680, 945
Hpy166II GTNNAC 4 cut(s) 320, 363, 647, 801
Hpy188I TCNGA 1 cut(s) 876
Hpy188III TCNNGA 5 cut(s) 146, 221, 335, 743, 821
Hpy8I GTNNAC 4 cut(s) 320, 363, 647, 801
Hpy99I CGWCG 1 cut(s) 95
HpyAV CCTTC 3 cut(s) 704, 871, 1051
HpyCH4IV ACGT 1 cut(s) 481
HpyCH4V TGCA 9 cut(s) 238, 280, 311, 368, 516, 520, 566, 635, 698
HpyF10VI GCNNNNNNNGC 1 cut(s) 513
HpyF3I CTNAG 5 cut(s) 428, 508, 792, 1017, 1104
HpySE526I ACGT 1 cut(s) 481
Hsp92II CATG 5 cut(s) 43, 520, 635, 824, 917
Kzo9I GATC 5 cut(s) 217, 578, 616, 624, 823
LmnI GCTCC 4 cut(s) 19, 116, 504, 659
LweI GCATC 2 cut(s) 319, 692
MaeI CTAG 2 cut(s) 743, 806
MaeII ACGT 1 cut(s) 481
MaeIII GTNAC 1 cut(s) 1062
MalI GATC 5 cut(s) 219, 580, 618, 626, 825
MboI GATC 5 cut(s) 217, 578, 616, 624, 823
MboII GAAGA 5 cut(s) 177, 488, 896, 929, 1024
MflI RGATCY 1 cut(s) 624
MlsI TGGCCA 1 cut(s) 129
MluCI AATT 9 cut(s) 155, 198, 226, 266, 284, 351, 369, 535, 730
MluNI TGGCCA 1 cut(s) 129
MlyI GAGTC 2 cut(s) 368, 875
MmeI TCCRAC 6 cut(s) 54, 509, 681, 854, 1062, 1068
Mox20I TGGCCA 1 cut(s) 129
Mph1103I ATGCAT 1 cut(s) 522
MscI TGGCCA 1 cut(s) 129
MseI TTAA 3 cut(s) 141, 347, 729
MslI CAYNNNNRTG 1 cut(s) 671
Msp20I TGGCCA 1 cut(s) 129
MspA1I CMGCKG 2 cut(s) 293, 326
MspI CCGG 1 cut(s) 762
MspR9I CCNGG 3 cut(s) 126, 492, 651
Mva1269I GAATGC 1 cut(s) 309
MvaI CCWGG 3 cut(s) 126, 492, 651
MvnI CGCG 1 cut(s) 246
MwoI GCNNNNNNNGC 1 cut(s) 513
NdeI CATATG 1 cut(s) 313
NdeII GATC 5 cut(s) 217, 578, 616, 624, 823
NlaIII CATG 5 cut(s) 43, 520, 635, 824, 917
NlaIV GGNNCC 2 cut(s) 488, 655
NmeAIII GCCGAG 1 cut(s) 469
NsiI ATGCAT 1 cut(s) 522
NspI RCATGY 3 cut(s) 43, 520, 635
NspV TTCGAA 1 cut(s) 301
PaeI GCATGC 2 cut(s) 520, 635
PaeR7I CTCGAG 1 cut(s) 596
PagI TCATGA 1 cut(s) 820
PcsI WCGNNNNNNNCGW 1 cut(s) 96
PctI GAATGC 1 cut(s) 309
PfeI GAWTC 3 cut(s) 101, 739, 1040
PinAI ACCGGT 1 cut(s) 761
PleI GAGTC 2 cut(s) 367, 874
PpsI GAGTC 2 cut(s) 367, 874
PshBI ATTAAT 1 cut(s) 141
PsiI TTATAA 1 cut(s) 735
Psp6I CCWGG 3 cut(s) 124, 490, 649
PspGI CCWGG 3 cut(s) 124, 490, 649
PspN4I GGNNCC 2 cut(s) 488, 655
PspPI GGNCC 2 cut(s) 833, 963
PspXI VCTCGAGB 1 cut(s) 596
PstNI CAGNNNCTG 2 cut(s) 125, 608
PsuI RGATCY 1 cut(s) 624
PvuII CAGCTG 2 cut(s) 293, 326
RsaI GTAC 1 cut(s) 321
RsaNI GTAC 1 cut(s) 320
RseI CAYNNNNRTG 1 cut(s) 671
SaqAI TTAA 3 cut(s) 141, 347, 729
Sau3AI GATC 5 cut(s) 217, 578, 616, 624, 823
Sau96I GGNCC 2 cut(s) 833, 963
SchI GAGTC 2 cut(s) 368, 875
ScrFI CCNGG 3 cut(s) 126, 492, 651
SfaNI GCATC 2 cut(s) 319, 692
SfcI CTRYAG 1 cut(s) 543
Sfr274I CTCGAG 1 cut(s) 596
SfuI TTCGAA 1 cut(s) 301
SinI GGWCC 1 cut(s) 833
SlaI CTCGAG 1 cut(s) 596
SmiMI CAYNNNNRTG 1 cut(s) 671
SmlI CTYRAG 2 cut(s) 596, 828
SmoI CTYRAG 2 cut(s) 596, 828
SpeI ACTAGT 1 cut(s) 805
SphI GCATGC 2 cut(s) 520, 635
Sse9I AATT 9 cut(s) 155, 198, 226, 266, 284, 351, 369, 535, 730
SsiI CCGC 2 cut(s) 203, 421
SspI AATATT 1 cut(s) 344
SspMI CTAG 2 cut(s) 743, 806
StyD4I CCNGG 3 cut(s) 124, 490, 649
TaiI ACGT 1 cut(s) 484
TaqI TCGA 5 cut(s) 104, 301, 373, 394, 597
TasI AATT 9 cut(s) 155, 198, 226, 266, 284, 351, 369, 535, 730
TfiI GAWTC 3 cut(s) 101, 739, 1040
Tru1I TTAA 3 cut(s) 141, 347, 729
Tru9I TTAA 3 cut(s) 141, 347, 729
TspDTI ATGAA 6 cut(s) 182, 354, 395, 809, 930, 957
VpaK11BI GGWCC 1 cut(s) 833
VspI ATTAAT 1 cut(s) 141
XapI RAATTY 2 cut(s) 155, 284
XbaI TCTAGA 1 cut(s) 742
XceI RCATGY 3 cut(s) 43, 520, 635
XhoI CTCGAG 1 cut(s) 596
XmiI GTMKAC 2 cut(s) 362, 800
XspI CTAG 2 cut(s) 743, 806
Zsp2I ATGCAT 1 cut(s) 522
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.