Rmu_sc0001744.1_g000005

Ribosomal protein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001744.1
OG0014879
Physical Location & Seq
Forward (+)
32761 .. 33858
1098 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001744.1_g000005.1.cds

Sequence Viewer

Length: 825 bp
atggcttcatttgatgaggagcaagatttattgcttcgcatgtatgtgaataataatcacctcttggcagagttggatgacaataaggacgacgaggccaaattgaggcgtagaggagcagttcctggccatatagttattaatcgtcctcgacaagaagctggatataatctatatatggactactttgctgaggtctctggaaaccgctatctaagaacacctaacgtcgaggatgttgcgagacttttggatataggtgaagaacgtgggttcccaggaatgttagggagcttagattgcatgcattggcattggaaaaattgttcaacagcttgggcaggaatgtatgcagggcgtagtagatcaccaactattatcctcgaggcagtagttgattatgatctttggatttggcatgcacattttggtttactaggctccaacaacgacatcaatgtgcttgaagcatctcacctatttggaaatcttgcagaaggtaaatctcctcccgttaattataagattctagaaaaagattatgacaccggttattatttagccgatggtatatatcctaagtggtctacactagtgcaaactattcatgatcctcaaggtccacaaaaagtattgtttgccaaaaaacaagagtcgtgtcggaaggatgttgaacgagcatttggagttcttcaatcatgttgggcaattgtcaagggaccaacacgtttttggaataaatgtgttttacatgatataatgactacatgcatcataatgcataacatgataatcgaagatgagtctaagtggtccaataaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Plant_tran

Protein Analysis

274

Amino Acids

31.5

Weight (kDa)

5.8

Isoelectric Point (pI)

58.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 522
AbsI CCTCGAGG 1 cut(s) 383
AccI GTMKAC 1 cut(s) 587
AciI CCGC 1 cut(s) 208
AclWI GGATC 1 cut(s) 605
AcoI YGGCCR 1 cut(s) 127
AfiI CCNNNNNNNGG 1 cut(s) 105
AflIII ACRYGT 1 cut(s) 725
AgeI ACCGGT 1 cut(s) 548
AgsI TTSAA 4 cut(s) 330, 467, 674, 695
AhlI ACTAGT 1 cut(s) 592
AjnI CCWGG 2 cut(s) 124, 277
AjuI GAANNNNNNNTTGG 2 cut(s) 666, 698
AloI GAACNNNNNNTCC 4 cut(s) 258, 290, 310, 342
AluBI AGCT 3 cut(s) 161, 294, 335
AluI AGCT 3 cut(s) 161, 294, 335
Alw26I GTCTC 2 cut(s) 202, 238
AlwI GGATC 1 cut(s) 605
AlwNI CAGNNNCTG 1 cut(s) 125
Ama87I CYCGRG 1 cut(s) 383
AoxI GGCC 2 cut(s) 96, 127
AseI ATTAAT 1 cut(s) 141
AsiGI ACCGGT 1 cut(s) 548
AspS9I GGNCC 3 cut(s) 620, 719, 813
AsuHPI GGTGA 4 cut(s) 50, 272, 360, 467
AvaI CYCGRG 1 cut(s) 383
AvaII GGWCC 3 cut(s) 620, 719, 813
BalI TGGCCA 1 cut(s) 129
BbvCI CCTCAGC 1 cut(s) 192
BccI CCATC 1 cut(s) 560
BcgI CGANNNNNNTGC 2 cut(s) 221, 255
BciT130I CCWGG 2 cut(s) 126, 279
BcoDI GTCTC 2 cut(s) 202, 238
BcuI ACTAGT 1 cut(s) 592
BfaI CTAG 3 cut(s) 437, 530, 593
Bme1390I CCNGG 2 cut(s) 126, 279
Bme18I GGWCC 3 cut(s) 620, 719, 813
BmeT110I CYCGRG 1 cut(s) 383
BmgT120I GGNCC 3 cut(s) 620, 719, 813
BmiI GGNNCC 3 cut(s) 275, 442, 720
BmrFI CCNGG 2 cut(s) 126, 279
BmsI GCATC 2 cut(s) 479, 780
Bpu10I CCTNAGC 1 cut(s) 192
BpuEI CTTGAG 1 cut(s) 600
BsaBI GATNNNNATC 1 cut(s) 402
BsaI GGTCTC 1 cut(s) 202
BsaJI CCNNGG 1 cut(s) 277
BsaWI WCCGGW 1 cut(s) 548
Bsc4I CCNNNNNNNGG 1 cut(s) 105
Bse118I RCCGGY 1 cut(s) 548
Bse8I GATNNNNATC 1 cut(s) 402
BseBI CCWGG 2 cut(s) 126, 279
BseDI CCNNGG 1 cut(s) 277
BseGI GGATG 3 cut(s) 82, 241, 673
BseJI GATNNNNATC 1 cut(s) 402
BseLI CCNNNNNNNGG 1 cut(s) 105
BseMII CTCAG 1 cut(s) 183
BseRI GAGGAG 3 cut(s) 32, 129, 498
BshFI GGCC 2 cut(s) 98, 129
BshTI ACCGGT 1 cut(s) 548
BsiHKCI CYCGRG 1 cut(s) 383
BsiSI CCGG 1 cut(s) 549
BslFI GGGAC 1 cut(s) 732
BslI CCNNNNNNNGG 1 cut(s) 105
BsmAI GTCTC 2 cut(s) 202, 238
BsmFI GGGAC 1 cut(s) 732
BsnI GGCC 2 cut(s) 98, 129
Bso31I GGTCTC 1 cut(s) 202
BsoBI CYCGRG 1 cut(s) 383
Bsp143I GATC 3 cut(s) 365, 403, 610
BspACI CCGC 1 cut(s) 208
BspANI GGCC 2 cut(s) 98, 129
BspCNI CTCAG 1 cut(s) 184
BspHI TCATGA 1 cut(s) 607
BspLI GGNNCC 3 cut(s) 275, 442, 720
BspPI GGATC 1 cut(s) 605
BspTNI GGTCTC 1 cut(s) 202
BsrFI RCCGGY 1 cut(s) 548
BssAI RCCGGY 1 cut(s) 548
BssECI CCNNGG 1 cut(s) 277
BssMI GATC 3 cut(s) 365, 403, 610
Bst2UI CCWGG 2 cut(s) 126, 279
BstC8I GCNNGC 2 cut(s) 305, 420
BstDEI CTNAG 5 cut(s) 192, 215, 295, 579, 807
BstF5I GGATG 3 cut(s) 82, 241, 673
BstKTI GATC 3 cut(s) 368, 406, 613
BstMAI GTCTC 2 cut(s) 202, 238
BstMBI GATC 3 cut(s) 365, 403, 610
BstMWI GCNNNNNNNGC 1 cut(s) 300
BstNI CCWGG 2 cut(s) 126, 279
BstNSI RCATGY 4 cut(s) 43, 307, 422, 771
BstSCI CCNGG 2 cut(s) 124, 277
BsuRI GGCC 2 cut(s) 98, 129
BtsCI GGATG 3 cut(s) 82, 241, 673
Cac8I GCNNGC 2 cut(s) 305, 420
CaiI CAGNNNCTG 1 cut(s) 125
CciI TCATGA 1 cut(s) 607
Cfr10I RCCGGY 1 cut(s) 548
Cfr13I GGNCC 3 cut(s) 620, 719, 813
CspAI ACCGGT 1 cut(s) 548
CviAII CATG 8 cut(s) 40, 304, 419, 608, 699, 752, 768, 787
CviJI RGCY 8 cut(s) 5, 98, 129, 161, 294, 335, 441, 563
CviKI_1 RGCY 8 cut(s) 5, 98, 129, 161, 294, 335, 441, 563
DdeI CTNAG 5 cut(s) 192, 215, 295, 579, 807
DpnI GATC 3 cut(s) 367, 405, 612
DpnII GATC 3 cut(s) 365, 403, 610
EaeI YGGCCR 1 cut(s) 127
Eco31I GGTCTC 1 cut(s) 202
Eco47I GGWCC 3 cut(s) 620, 719, 813
Eco88I CYCGRG 1 cut(s) 383
EcoRII CCWGG 2 cut(s) 124, 277
EcoT22I ATGCAT 3 cut(s) 309, 773, 783
FaeI CATG 8 cut(s) 43, 307, 422, 611, 702, 755, 771, 790
FaqI GGGAC 1 cut(s) 732
FatI CATG 8 cut(s) 39, 303, 418, 607, 698, 751, 767, 786
FblI GTMKAC 1 cut(s) 587
FokI GGATG 3 cut(s) 89, 248, 680
FspBI CTAG 3 cut(s) 437, 530, 593
HaeIII GGCC 2 cut(s) 98, 129
HapII CCGG 1 cut(s) 549
Hin1II CATG 8 cut(s) 43, 307, 422, 611, 702, 755, 771, 790
HinfI GANTC 3 cut(s) 526, 653, 803
HpaII CCGG 1 cut(s) 549
HphI GGTGA 4 cut(s) 50, 272, 360, 467
Hpy166II GTNNAC 3 cut(s) 434, 588, 623
Hpy188I TCNGA 1 cut(s) 663
Hpy188III TCNNGA 3 cut(s) 201, 530, 608
Hpy8I GTNNAC 3 cut(s) 434, 588, 623
Hpy99I CGWCG 2 cut(s) 95, 233
HpyAV CCTTC 2 cut(s) 491, 658
HpyCH4IV ACGT 3 cut(s) 228, 268, 727
HpyCH4V TGCA 8 cut(s) 303, 307, 353, 422, 494, 598, 771, 781
HpyF10VI GCNNNNNNNGC 1 cut(s) 300
HpyF3I CTNAG 5 cut(s) 192, 215, 295, 579, 807
HpySE526I ACGT 3 cut(s) 228, 268, 727
Hsp92II CATG 8 cut(s) 43, 307, 422, 611, 702, 755, 771, 790
Kzo9I GATC 3 cut(s) 365, 403, 610
LmnI GCTCC 4 cut(s) 19, 116, 291, 446
LpnPI CCDG 9 cut(s) 111, 138, 147, 186, 264, 291, 327, 339, 562
LweI GCATC 2 cut(s) 479, 780
MaeI CTAG 3 cut(s) 437, 530, 593
MaeII ACGT 3 cut(s) 228, 268, 727
MalI GATC 3 cut(s) 367, 405, 612
MboI GATC 3 cut(s) 365, 403, 610
MboII GAAGA 3 cut(s) 275, 683, 809
MfeI CAATTG 1 cut(s) 708
MlsI TGGCCA 1 cut(s) 129
MluCI AATT 4 cut(s) 101, 322, 517, 708
MluNI TGGCCA 1 cut(s) 129
MlyI GAGTC 2 cut(s) 662, 812
MmeI TCCRAC 3 cut(s) 54, 468, 641
Mox20I TGGCCA 1 cut(s) 129
Mph1103I ATGCAT 3 cut(s) 309, 773, 783
MscI TGGCCA 1 cut(s) 129
MseI TTAA 2 cut(s) 141, 516
MslI CAYNNNNRTG 3 cut(s) 44, 458, 776
Msp20I TGGCCA 1 cut(s) 129
MspI CCGG 1 cut(s) 549
MspR9I CCNGG 2 cut(s) 126, 279
MunI CAATTG 1 cut(s) 708
MvaI CCWGG 2 cut(s) 126, 279
MwoI GCNNNNNNNGC 1 cut(s) 300
NdeII GATC 3 cut(s) 365, 403, 610
NlaIII CATG 8 cut(s) 43, 307, 422, 611, 702, 755, 771, 790
NlaIV GGNNCC 3 cut(s) 275, 442, 720
NsiI ATGCAT 3 cut(s) 309, 773, 783
NspI RCATGY 4 cut(s) 43, 307, 422, 771
PaeI GCATGC 2 cut(s) 307, 422
PaeR7I CTCGAG 1 cut(s) 383
PagI TCATGA 1 cut(s) 607
PfeI GAWTC 1 cut(s) 526
PinAI ACCGGT 1 cut(s) 548
PleI GAGTC 2 cut(s) 661, 811
PpsI GAGTC 2 cut(s) 661, 811
PshBI ATTAAT 1 cut(s) 141
PsiI TTATAA 1 cut(s) 522
Psp6I CCWGG 2 cut(s) 124, 277
PspGI CCWGG 2 cut(s) 124, 277
PspN4I GGNNCC 3 cut(s) 275, 442, 720
PspPI GGNCC 3 cut(s) 620, 719, 813
PspXI VCTCGAGB 1 cut(s) 383
PstNI CAGNNNCTG 1 cut(s) 125
RseI CAYNNNNRTG 3 cut(s) 44, 458, 776
SaqAI TTAA 2 cut(s) 141, 516
Sau3AI GATC 3 cut(s) 365, 403, 610
Sau96I GGNCC 3 cut(s) 620, 719, 813
SchI GAGTC 2 cut(s) 662, 812
ScrFI CCNGG 2 cut(s) 126, 279
SfaNI GCATC 2 cut(s) 479, 780
Sfr274I CTCGAG 1 cut(s) 383
SinI GGWCC 3 cut(s) 620, 719, 813
SlaI CTCGAG 1 cut(s) 383
SmiMI CAYNNNNRTG 3 cut(s) 44, 458, 776
SmlI CTYRAG 2 cut(s) 383, 615
SmoI CTYRAG 2 cut(s) 383, 615
SpeI ACTAGT 1 cut(s) 592
SphI GCATGC 2 cut(s) 307, 422
Sse9I AATT 4 cut(s) 101, 322, 517, 708
SsiI CCGC 1 cut(s) 208
SspMI CTAG 3 cut(s) 437, 530, 593
StyD4I CCNGG 2 cut(s) 124, 277
TaiI ACGT 3 cut(s) 231, 271, 730
TaqI TCGA 4 cut(s) 151, 231, 384, 795
TasI AATT 4 cut(s) 101, 322, 517, 708
TfiI GAWTC 1 cut(s) 526
Tru1I TTAA 2 cut(s) 141, 516
Tru9I TTAA 2 cut(s) 141, 516
TspDTI ATGAA 1 cut(s) 596
VpaK11BI GGWCC 3 cut(s) 620, 719, 813
VspI ATTAAT 1 cut(s) 141
XbaI TCTAGA 1 cut(s) 529
XceI RCATGY 4 cut(s) 43, 307, 422, 771
XcmI CCANNNNNNNNNTGG 1 cut(s) 729
XhoI CTCGAG 1 cut(s) 383
XmiI GTMKAC 1 cut(s) 587
XspI CTAG 3 cut(s) 437, 530, 593
Zsp2I ATGCAT 3 cut(s) 309, 773, 783
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.