AT5G37475

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0008374
Physical Location & Seq
Reverse (-)
14866057 .. 14868775
2719 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G37475.2

Sequence Viewer

Length: 678 bp
ATGGATGATTGGGAGGCCGAGGACTTTCAACCACTTCCCTCAAAAGTTGAACTGAAAAGTAACTGGGATGATGAGGATGTGGATGAGAATGATATCAAGGACTCGTGGGAGGAGGAAGATGTATCTGCTCCGCCACCTATAGTAAAGCCTGCTTCTGAGAAGGCTCCAAAGAAACCAGCAGTAAAAGCTGTTGAAAAGAAGGTTAAAACTGTTGAAGCTCCGAAAGGAACATCAAGGGAAGAACCTCTAGATCCTATTGCTGAGAAACTTCGCATGCAGAGGCTTGTAGAGGAAGCTGATTACCAATCAACTGCTGAACTCTTTGGAGTAAAGACTGAAGAGAAAAGCGTCGATATGTTAATTCCGAAGTCTGAAAGCGATTTCTTGGATTATGCTGAGTTGATATCTCAGAGACTTGTACCATTTGAGAAAAGCTTTCACTATATCGGGCTACTCAAAGCAGTGATGAGACTTTCTGTGGCTAATATGAAAGCAGCAGATGTTAAAGACGTTGCTTCGTCCATTACAGCTATAGCAAATGAAAAATTGAAGGCGGAGAAAGAAGCTGCTGCTGGCAAAAAGAAGTCAGGTAAGAAGAAACAACTTCATGTTGATAAGCCTGATGATGATCTTGTTTCGGGTCCTTATGATGCCATGGACGATGATGATTTCATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03013 map03013
Pfam Domains
Protein Families
eIF3_subunit

Protein Analysis

225

Amino Acids

25.17

Weight (kDa)

4.69

Isoelectric Point (pI)

33.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
eIF3_subunit PF08597 2 - 225 4.2e-55 Translation initiation factor eIF3 subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 131, 554
AclWI GGATC 1 cut(s) 245
AcuI CTGAAG 1 cut(s) 357
AfaI GTAC 1 cut(s) 420
AgsI TTSAA 5 cut(s) 29, 50, 194, 215, 550
AluBI AGCT 6 cut(s) 188, 218, 296, 435, 530, 566
AluI AGCT 6 cut(s) 188, 218, 296, 435, 530, 566
Alw26I GTCTC 2 cut(s) 406, 463
AlwI GGATC 1 cut(s) 245
AoxI GGCC 1 cut(s) 15
ApeKI GCWGC 3 cut(s) 494, 566, 569
AspS9I GGNCC 1 cut(s) 641
AvaII GGWCC 1 cut(s) 641
BauI CACGAG 1 cut(s) 103
BbvI GCAGC 3 cut(s) 506, 553, 556
BcoDI GTCTC 2 cut(s) 406, 463
BfaI CTAG 1 cut(s) 248
BfmI CTRYAG 2 cut(s) 138, 531
BisI GCNGC 3 cut(s) 495, 567, 570
BlsI GCNGC 3 cut(s) 496, 568, 571
Bme18I GGWCC 1 cut(s) 641
BmgT120I GGNCC 1 cut(s) 641
BmiI GGNNCC 2 cut(s) 165, 642
BmrI ACTGGG 1 cut(s) 73
BmsI GCATC 1 cut(s) 640
BmuI ACTGGG 1 cut(s) 73
BsaBI GATNNNNATC 1 cut(s) 627
BsaJI CCNNGG 2 cut(s) 18, 654
Bse1I ACTGG 1 cut(s) 68
Bse8I GATNNNNATC 1 cut(s) 627
BseDI CCNNGG 2 cut(s) 18, 654
BseGI GGATG 4 cut(s) 10, 73, 82, 88
BseJI GATNNNNATC 1 cut(s) 627
BseMII CTCAG 4 cut(s) 147, 252, 387, 422
BseNI ACTGG 1 cut(s) 68
BseRI GAGGAG 1 cut(s) 125
BseXI GCAGC 3 cut(s) 506, 553, 556
BshFI GGCC 1 cut(s) 17
BsmAI GTCTC 2 cut(s) 406, 463
BsnI GGCC 1 cut(s) 17
Bsp143I GATC 2 cut(s) 250, 628
Bsp19I CCATGG 1 cut(s) 654
BspACI CCGC 2 cut(s) 131, 554
BspANI GGCC 1 cut(s) 17
BspCNI CTCAG 4 cut(s) 148, 253, 388, 421
BspLI GGNNCC 2 cut(s) 165, 642
BspPI GGATC 1 cut(s) 245
BsrI ACTGG 1 cut(s) 68
BssECI CCNNGG 2 cut(s) 18, 654
BssMI GATC 2 cut(s) 250, 628
BssSI CACGAG 1 cut(s) 103
BssT1I CCWWGG 1 cut(s) 654
Bst2BI CACGAG 1 cut(s) 103
Bst4CI ACNGT 1 cut(s) 211
Bst6I CTCTTC 1 cut(s) 333
BstC8I GCNNGC 3 cut(s) 150, 275, 574
BstDEI CTNAG 4 cut(s) 156, 261, 396, 408
BstDSI CCRYGG 1 cut(s) 654
BstF5I GGATG 4 cut(s) 10, 73, 82, 88
BstKTI GATC 2 cut(s) 253, 631
BstMAI GTCTC 2 cut(s) 406, 463
BstMBI GATC 2 cut(s) 250, 628
BstMWI GCNNNNNNNGC 1 cut(s) 185
BstNSI RCATGY 1 cut(s) 277
BstSFI CTRYAG 2 cut(s) 138, 531
BstV1I GCAGC 3 cut(s) 506, 553, 556
BstX2I RGATCY 1 cut(s) 250
BstYI RGATCY 1 cut(s) 250
BsuRI GGCC 1 cut(s) 17
BtgI CCRYGG 1 cut(s) 654
BtsCI GGATG 4 cut(s) 10, 73, 82, 88
BtsI GCAGTG 1 cut(s) 468
BtsIMutI CAGTG 1 cut(s) 468
Cac8I GCNNGC 3 cut(s) 150, 275, 574
Cfr13I GGNCC 1 cut(s) 641
CseI GACGC 1 cut(s) 337
Csp6I GTAC 1 cut(s) 419
CviAII CATG 4 cut(s) 274, 608, 655, 673
CviQI GTAC 1 cut(s) 419
DdeI CTNAG 4 cut(s) 156, 261, 396, 408
DpnI GATC 2 cut(s) 252, 630
DpnII GATC 2 cut(s) 250, 628
Eam1104I CTCTTC 1 cut(s) 333
EarI CTCTTC 1 cut(s) 333
EciI GGCGGA 2 cut(s) 120, 569
Eco130I CCWWGG 1 cut(s) 654
Eco32I GATATC 2 cut(s) 94, 405
Eco47I GGWCC 1 cut(s) 641
Eco57I CTGAAG 1 cut(s) 357
EcoO109I RGGNCCY 1 cut(s) 641
EcoRV GATATC 2 cut(s) 94, 405
EcoT14I CCWWGG 1 cut(s) 654
ErhI CCWWGG 1 cut(s) 654
FaeI CATG 4 cut(s) 277, 611, 658, 676
FatI CATG 4 cut(s) 273, 607, 654, 672
Fnu4HI GCNGC 3 cut(s) 495, 567, 570
FokI GGATG 4 cut(s) 17, 80, 89, 95
Fsp4HI GCNGC 3 cut(s) 495, 567, 570
FspBI CTAG 1 cut(s) 248
GluI GCNGC 3 cut(s) 495, 567, 570
HaeIII GGCC 1 cut(s) 17
HgaI GACGC 1 cut(s) 337
Hin1II CATG 4 cut(s) 277, 611, 658, 676
HindIII AAGCTT 1 cut(s) 433
HinfI GANTC 1 cut(s) 101
Hpy188I TCNGA 5 cut(s) 157, 222, 366, 373, 411
Hpy188III TCNNGA 1 cut(s) 248
Hpy99I CGWCG 1 cut(s) 353
HpyAV CCTTC 3 cut(s) 154, 193, 544
HpyCH4III ACNGT 1 cut(s) 211
HpyCH4IV ACGT 1 cut(s) 510
HpyCH4V TGCA 1 cut(s) 277
HpyF10VI GCNNNNNNNGC 1 cut(s) 185
HpyF3I CTNAG 4 cut(s) 156, 261, 396, 408
HpySE526I ACGT 1 cut(s) 510
Hsp92II CATG 4 cut(s) 277, 611, 658, 676
Kzo9I GATC 2 cut(s) 250, 628
LmnI GCTCC 3 cut(s) 133, 169, 223
LpnPI CCDG 6 cut(s) 49, 162, 189, 558, 573, 633
Lsp1109I GCAGC 3 cut(s) 506, 553, 556
LweI GCATC 1 cut(s) 640
MaeI CTAG 1 cut(s) 248
MaeII ACGT 1 cut(s) 510
MaeIII GTNAC 1 cut(s) 59
MalI GATC 2 cut(s) 252, 630
MboI GATC 2 cut(s) 250, 628
MboII GAAGA 4 cut(s) 128, 251, 350, 607
MflI RGATCY 1 cut(s) 250
MluCI AATT 2 cut(s) 360, 545
MlyI GAGTC 1 cut(s) 95
MnlI CCTC 9 cut(s) 7, 13, 49, 67, 103, 106, 255, 273, 283
MseI TTAA 3 cut(s) 204, 359, 504
MwoI GCNNNNNNNGC 1 cut(s) 185
NcoI CCATGG 1 cut(s) 654
NdeII GATC 2 cut(s) 250, 628
NlaIII CATG 4 cut(s) 277, 611, 658, 676
NlaIV GGNNCC 2 cut(s) 165, 642
NmeAIII GCCGAG 1 cut(s) 43
NspI RCATGY 1 cut(s) 277
PaeI GCATGC 1 cut(s) 277
PkrI GCNGC 3 cut(s) 496, 568, 571
PleI GAGTC 1 cut(s) 95
PpsI GAGTC 1 cut(s) 95
PpuMI RGGWCCY 1 cut(s) 641
Psp5II RGGWCCY 1 cut(s) 641
PspN4I GGNNCC 2 cut(s) 165, 642
PspPI GGNCC 1 cut(s) 641
PspPPI RGGWCCY 1 cut(s) 641
PsuI RGATCY 1 cut(s) 250
RsaI GTAC 1 cut(s) 420
RsaNI GTAC 1 cut(s) 419
SaqAI TTAA 3 cut(s) 204, 359, 504
SatI GCNGC 3 cut(s) 495, 567, 570
Sau3AI GATC 2 cut(s) 250, 628
Sau96I GGNCC 1 cut(s) 641
SchI GAGTC 1 cut(s) 95
SfaNI GCATC 1 cut(s) 640
SfcI CTRYAG 2 cut(s) 138, 531
SinI GGWCC 1 cut(s) 641
SphI GCATGC 1 cut(s) 277
Sse9I AATT 2 cut(s) 360, 545
SsiI CCGC 2 cut(s) 131, 554
SspMI CTAG 1 cut(s) 248
StyI CCWWGG 1 cut(s) 654
TaaI ACNGT 1 cut(s) 211
TaiI ACGT 1 cut(s) 513
TaqI TCGA 1 cut(s) 351
TasI AATT 2 cut(s) 360, 545
Tru1I TTAA 3 cut(s) 204, 359, 504
Tru9I TTAA 3 cut(s) 204, 359, 504
TscAI CASTG 1 cut(s) 468
TseI GCWGC 3 cut(s) 494, 566, 569
TspDTI ATGAA 4 cut(s) 503, 555, 596, 661
TspRI CASTG 1 cut(s) 468
VpaK11BI GGWCC 1 cut(s) 641
XbaI TCTAGA 1 cut(s) 247
XceI RCATGY 1 cut(s) 277
XspI CTAG 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.