FvH4_5g23100

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Reverse (-)
14448144 .. 14452565
4422 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g23100.t1

Sequence Viewer

Length: 678 bp
ATGGAGGACTGGGAAGAAGATGTGCAAGTTCCATCTCTCCTTTCTAAGGAGCCAGTGGTAAGAAGTAACTGGGATGATGAAGATGCTGATGACAATGAGGTGAAGGATTCATGGGAGGATGATGATGAACCTGCTCCTCCGGCACCTGCACCAAAAGCTCCTGCTGAAAAGGCACCCAGGAAACCTGCAGCAAAGGCTGCAGAAAAGAAAGGAAAAGCTGTTGAAGTAGAAAAGGAAGAGTCACTAGATCCCCTGGCTGAGAAACTTCGCCAACAAAGACTGGTGGAAGAAGCAGATTATAAGGCCACTAAAGAACTTTTTTCTACTAGAGGTGAAGAGAAAAACATTGACAATTTCATTCCCAAATCGGAAAGTGACTTTCTGGAATATGCAGAACTCATTTCACATAAACTTCGTCCATTTGAGAAAAGTTTTCATTATATCGGTCTACTTAAGGCAGTTATGAGATTGTCAATGACCTCCTTGAAAGGAGCAGATGCAAAAGATGTTGCATCTTCAATCACGGCAATTGCAAATGAGAAGATAAAAGCTGAGAAGGAAGCCAATGCTGGTAAAAAGAAGACAGGTGCCAAGAAAAAGCAGCTTCATGTTGATAAGCCGGATGATGATATAGCTGTTGATGGTTATGATCCCCTCGATGACTATGACTTTATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

226

Amino Acids

25.23

Weight (kDa)

4.76

Isoelectric Point (pI)

40.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
eIF3_subunit PF08597 3 - 225 4.4e-53 Translation initiation factor eIF3 subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 300
AarI CACCTGC 1 cut(s) 154
Acc36I ACCTGC 3 cut(s) 139, 154, 193
AccB1I GGYRCC 3 cut(s) 142, 172, 587
AccI GTMKAC 1 cut(s) 448
AclWI GGATC 2 cut(s) 242, 644
AfiI CCNNNNNNNGG 1 cut(s) 46
AflII CTTAAG 1 cut(s) 452
AgsI TTSAA 3 cut(s) 224, 487, 519
AjnI CCWGG 2 cut(s) 176, 252
AluBI AGCT 5 cut(s) 158, 218, 551, 604, 635
AluI AGCT 5 cut(s) 158, 218, 551, 604, 635
AlwI GGATC 2 cut(s) 242, 644
AoxI GGCC 1 cut(s) 303
ApeKI GCWGC 3 cut(s) 188, 197, 601
AsuHPI GGTGA 2 cut(s) 112, 344
BanI GGYRCC 3 cut(s) 142, 172, 587
BbsI GAAGAC 1 cut(s) 587
BbvI GCAGC 3 cut(s) 184, 200, 613
BccI CCATC 2 cut(s) 40, 635
BceAI ACGGC 1 cut(s) 540
BciT130I CCWGG 2 cut(s) 178, 254
BfaI CTAG 2 cut(s) 245, 327
BfmI CTRYAG 2 cut(s) 186, 198
BfrI CTTAAG 1 cut(s) 452
BfuAI ACCTGC 3 cut(s) 139, 154, 193
BisI GCNGC 3 cut(s) 189, 198, 602
BlsI GCNGC 3 cut(s) 190, 199, 603
Bme1390I CCNGG 2 cut(s) 178, 254
BmiI GGNNCC 4 cut(s) 51, 144, 174, 589
BmrFI CCNGG 2 cut(s) 178, 254
BmrI ACTGGG 2 cut(s) 19, 79
BmsI GCATC 3 cut(s) 73, 487, 521
BmuI ACTGGG 2 cut(s) 19, 79
BpiI GAAGAC 1 cut(s) 587
BsaJI CCNNGG 2 cut(s) 176, 252
Bsc4I CCNNNNNNNGG 1 cut(s) 46
Bse1I ACTGG 4 cut(s) 14, 53, 74, 285
BseBI CCWGG 2 cut(s) 178, 254
BseDI CCNNGG 2 cut(s) 176, 252
BseGI GGATG 3 cut(s) 79, 124, 628
BseLI CCNNNNNNNGG 1 cut(s) 46
BseMII CTCAG 2 cut(s) 249, 543
BseNI ACTGG 4 cut(s) 14, 53, 74, 285
BseRI GAGGAG 1 cut(s) 126
BseXI GCAGC 3 cut(s) 184, 200, 613
BsgI GTGCAG 1 cut(s) 132
BshFI GGCC 1 cut(s) 305
BshNI GGYRCC 3 cut(s) 142, 172, 587
BsiSI CCGG 2 cut(s) 140, 620
BslI CCNNNNNNNGG 1 cut(s) 46
BsnI GGCC 1 cut(s) 305
Bsp143I GATC 2 cut(s) 247, 649
BspANI GGCC 1 cut(s) 305
BspCNI CTCAG 2 cut(s) 250, 544
BspLI GGNNCC 4 cut(s) 51, 144, 174, 589
BspMAI CTGCAG 2 cut(s) 190, 202
BspMI ACCTGC 3 cut(s) 139, 154, 193
BspPI GGATC 2 cut(s) 242, 644
BspT107I GGYRCC 3 cut(s) 142, 172, 587
BspTI CTTAAG 1 cut(s) 452
BsrI ACTGG 4 cut(s) 14, 53, 74, 285
BssECI CCNNGG 2 cut(s) 176, 252
BssMI GATC 2 cut(s) 247, 649
Bst2UI CCWGG 2 cut(s) 178, 254
Bst6I CTCTTC 2 cut(s) 231, 330
BstAFI CTTAAG 1 cut(s) 452
BstAPI GCANNNNNTGC 1 cut(s) 197
BstDEI CTNAG 3 cut(s) 45, 258, 552
BstENI CCTNNNNNAGG 1 cut(s) 44
BstF5I GGATG 3 cut(s) 79, 124, 628
BstKTI GATC 2 cut(s) 250, 652
BstMBI GATC 2 cut(s) 247, 649
BstMWI GCNNNNNNNGC 5 cut(s) 140, 155, 170, 194, 197
BstNI CCWGG 2 cut(s) 178, 254
BstSCI CCNGG 2 cut(s) 176, 252
BstSFI CTRYAG 2 cut(s) 186, 198
BstV1I GCAGC 3 cut(s) 184, 200, 613
BstV2I GAAGAC 1 cut(s) 587
BstX2I RGATCY 1 cut(s) 247
BstYI RGATCY 1 cut(s) 247
BsuRI GGCC 1 cut(s) 305
BtsCI GGATG 3 cut(s) 79, 124, 628
BtsIMutI CAGTG 1 cut(s) 60
BveI ACCTGC 3 cut(s) 139, 154, 193
CviAII CATG 2 cut(s) 111, 608
DdeI CTNAG 3 cut(s) 45, 258, 552
DpnI GATC 2 cut(s) 249, 651
DpnII GATC 2 cut(s) 247, 649
Eam1104I CTCTTC 2 cut(s) 231, 330
EarI CTCTTC 2 cut(s) 231, 330
EcoNI CCTNNNNNAGG 1 cut(s) 44
EcoRII CCWGG 2 cut(s) 176, 252
FaeI CATG 2 cut(s) 114, 611
FatI CATG 2 cut(s) 110, 607
FblI GTMKAC 1 cut(s) 448
Fnu4HI GCNGC 3 cut(s) 189, 198, 602
FokI GGATG 3 cut(s) 86, 131, 635
Fsp4HI GCNGC 3 cut(s) 189, 198, 602
FspBI CTAG 2 cut(s) 245, 327
GluI GCNGC 3 cut(s) 189, 198, 602
HaeIII GGCC 1 cut(s) 305
HapII CCGG 2 cut(s) 140, 620
Hin1II CATG 2 cut(s) 114, 611
HinfI GANTC 2 cut(s) 107, 239
HpaII CCGG 2 cut(s) 140, 620
HphI GGTGA 2 cut(s) 112, 344
Hpy166II GTNNAC 1 cut(s) 449
Hpy188I TCNGA 1 cut(s) 370
Hpy188III TCNNGA 1 cut(s) 383
Hpy8I GTNNAC 1 cut(s) 449
HpyAV CCTTC 2 cut(s) 97, 550
HpyCH4V TGCA 8 cut(s) 25, 149, 188, 200, 392, 500, 512, 533
HpyF10VI GCNNNNNNNGC 5 cut(s) 140, 155, 170, 194, 197
HpyF3I CTNAG 3 cut(s) 45, 258, 552
Hsp92II CATG 2 cut(s) 114, 611
Kzo9I GATC 2 cut(s) 247, 649
LmnI GCTCC 4 cut(s) 49, 139, 163, 491
Lsp1109I GCAGC 3 cut(s) 184, 200, 613
LweI GCATC 3 cut(s) 73, 487, 521
MaeI CTAG 2 cut(s) 245, 327
MaeIII GTNAC 3 cut(s) 65, 240, 374
MalI GATC 2 cut(s) 249, 651
MboI GATC 2 cut(s) 247, 649
MboII GAAGA 9 cut(s) 26, 29, 92, 248, 299, 347, 507, 553, 592
MfeI CAATTG 1 cut(s) 528
MflI RGATCY 1 cut(s) 247
MluCI AATT 2 cut(s) 352, 528
MlyI GAGTC 1 cut(s) 248
MnlI CCTC 6 cut(s) 91, 109, 147, 323, 490, 665
MseI TTAA 1 cut(s) 453
MspCI CTTAAG 1 cut(s) 452
MspI CCGG 2 cut(s) 140, 620
MspR9I CCNGG 2 cut(s) 178, 254
MunI CAATTG 1 cut(s) 528
MvaI CCWGG 2 cut(s) 178, 254
MwoI GCNNNNNNNGC 5 cut(s) 140, 155, 170, 194, 197
NdeII GATC 2 cut(s) 247, 649
NlaIII CATG 2 cut(s) 114, 611
NlaIV GGNNCC 4 cut(s) 51, 144, 174, 589
NmuCI GTSAC 2 cut(s) 240, 374
PaqCI CACCTGC 1 cut(s) 154
PfeI GAWTC 1 cut(s) 107
PkrI GCNGC 3 cut(s) 190, 199, 603
PleI GAGTC 1 cut(s) 247
PpsI GAGTC 1 cut(s) 247
PsiI TTATAA 1 cut(s) 300
Psp6I CCWGG 2 cut(s) 176, 252
PspGI CCWGG 2 cut(s) 176, 252
PspN4I GGNNCC 4 cut(s) 51, 144, 174, 589
PstI CTGCAG 2 cut(s) 190, 202
PsuI RGATCY 1 cut(s) 247
SaqAI TTAA 1 cut(s) 453
SatI GCNGC 3 cut(s) 189, 198, 602
Sau3AI GATC 2 cut(s) 247, 649
SchI GAGTC 1 cut(s) 248
ScrFI CCNGG 2 cut(s) 178, 254
SfaNI GCATC 3 cut(s) 73, 487, 521
SfcI CTRYAG 2 cut(s) 186, 198
SmlI CTYRAG 1 cut(s) 452
SmoI CTYRAG 1 cut(s) 452
Sse9I AATT 2 cut(s) 352, 528
SspMI CTAG 2 cut(s) 245, 327
StyD4I CCNGG 2 cut(s) 176, 252
TaqI TCGA 1 cut(s) 657
TaqII GACCGA 1 cut(s) 434
TasI AATT 2 cut(s) 352, 528
TfiI GAWTC 1 cut(s) 107
Tru1I TTAA 1 cut(s) 453
Tru9I TTAA 1 cut(s) 453
TscAI CASTG 1 cut(s) 60
TseFI GTSAC 2 cut(s) 240, 374
TseI GCWGC 3 cut(s) 188, 197, 601
Tsp45I GTSAC 2 cut(s) 240, 374
TspDTI ATGAA 6 cut(s) 93, 99, 141, 346, 425, 596
TspRI CASTG 1 cut(s) 60
Vha464I CTTAAG 1 cut(s) 452
XagI CCTNNNNNAGG 1 cut(s) 44
XmiI GTMKAC 1 cut(s) 448
XspI CTAG 2 cut(s) 245, 327
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.