ATCG00710

One of the components of the core complex of photosystem II (PSII), required for its stability and or assembly. PSII is a light-driven water plastoquinone oxidoreductase that uses light energy to abstract electrons from H(2)O, generating O(2) and a proton gradient subsequently used for ATP formation. It consists of a core antenna complex that captures photons, and an electron transfer chain that converts photonic excitation into a charge separation

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
Pt
Physical Location & Seq
Forward (+)
74485 .. 74706
222 bp
Loading structure...
UTR
Exon/CDS
Intron
ATCG00710.1

Sequence Viewer

Length: 222 bp
ATGGCTACACAAACTGTTGAAGATAGTTCTAGATCTGGTCCAAGAAGCACTACTGTAGGGAAGTTATTGAAACCATTGAATTCCGAATATGGTAAAGTAGCTCCCGGATGGGGAACGACCCCTTTGATGGGTGTTGCAATGGCTCTATTTGCGGTATTCCTATCTATTATTTTGGAGATTTATAATTCTTCTGTTCTACTGGATGGAATTTCAGTGAATTAG

Protein Analysis

73

Amino Acids

7.7

Weight (kDa)

6.04

Isoelectric Point (pI)

35.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsbH PF00737 16 - 67 1.2e-31 Photosystem II 10 kDa phosphoprotein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 183
AciI CCGC 1 cut(s) 152
AcsI RAATTY 2 cut(s) 79, 207
AfiI CCNNNNNNNGG 3 cut(s) 110, 127, 128
AgsI TTSAA 3 cut(s) 20, 70, 79
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
ApoI RAATTY 2 cut(s) 79, 207
AspS9I GGNCC 1 cut(s) 38
AsuC2I CCSGG 1 cut(s) 105
AvaII GGWCC 1 cut(s) 38
BccI CCATC 3 cut(s) 102, 121, 197
BcnI CCSGG 1 cut(s) 105
BfaI CTAG 1 cut(s) 30
BfmI CTRYAG 1 cut(s) 54
BglII AGATCT 1 cut(s) 32
Bme1390I CCNGG 1 cut(s) 105
Bme18I GGWCC 1 cut(s) 38
BmgT120I GGNCC 1 cut(s) 38
BmrFI CCNGG 1 cut(s) 105
BpuMI CCSGG 1 cut(s) 105
Bsc4I CCNNNNNNNGG 3 cut(s) 110, 127, 128
Bse1I ACTGG 1 cut(s) 204
Bse3DI GCAATG 1 cut(s) 144
BseGI GGATG 2 cut(s) 113, 208
BseLI CCNNNNNNNGG 3 cut(s) 110, 127, 128
BseMI GCAATG 1 cut(s) 144
BseNI ACTGG 1 cut(s) 204
BsiSI CCGG 1 cut(s) 105
BslI CCNNNNNNNGG 3 cut(s) 110, 127, 128
Bsp143I GATC 1 cut(s) 32
BspACI CCGC 1 cut(s) 152
BsrDI GCAATG 1 cut(s) 144
BsrI ACTGG 1 cut(s) 204
BssMI GATC 1 cut(s) 32
Bst4CI ACNGT 2 cut(s) 16, 55
BstF5I GGATG 2 cut(s) 113, 208
BstKTI GATC 1 cut(s) 35
BstMBI GATC 1 cut(s) 32
BstMWI GCNNNNNNNGC 1 cut(s) 149
BstSCI CCNGG 1 cut(s) 103
BstSFI CTRYAG 1 cut(s) 54
BstX2I RGATCY 1 cut(s) 32
BstYI RGATCY 1 cut(s) 32
BtsCI GGATG 2 cut(s) 113, 208
BtsIMutI CAGTG 1 cut(s) 219
Cfr13I GGNCC 1 cut(s) 38
CviJI RGCY 3 cut(s) 5, 101, 143
CviKI_1 RGCY 3 cut(s) 5, 101, 143
DpnI GATC 1 cut(s) 34
DpnII GATC 1 cut(s) 32
Eco47I GGWCC 1 cut(s) 38
EcoRI GAATTC 1 cut(s) 79
FaiI YATR 2 cut(s) 90, 183
FokI GGATG 2 cut(s) 120, 215
FspBI CTAG 1 cut(s) 30
HapII CCGG 1 cut(s) 105
HpaII CCGG 1 cut(s) 105
Hpy188I TCNGA 1 cut(s) 85
Hpy188III TCNNGA 1 cut(s) 30
HpyCH4III ACNGT 2 cut(s) 16, 55
HpyCH4V TGCA 1 cut(s) 137
HpyF10VI GCNNNNNNNGC 1 cut(s) 149
Kzo9I GATC 1 cut(s) 32
LmnI GCTCC 1 cut(s) 106
LpnPI CCDG 3 cut(s) 21, 118, 185
MaeI CTAG 1 cut(s) 30
MalI GATC 1 cut(s) 34
MboI GATC 1 cut(s) 32
MboII GAAGA 2 cut(s) 32, 180
MflI RGATCY 1 cut(s) 32
MluCI AATT 4 cut(s) 79, 184, 207, 217
MspI CCGG 1 cut(s) 105
MspR9I CCNGG 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 149
NciI CCSGG 1 cut(s) 105
NdeII GATC 1 cut(s) 32
PfoI TCCNGGA 1 cut(s) 103
PsiI TTATAA 1 cut(s) 183
PspPI GGNCC 1 cut(s) 38
PsuI RGATCY 1 cut(s) 32
Sau3AI GATC 1 cut(s) 32
Sau96I GGNCC 1 cut(s) 38
ScrFI CCNGG 1 cut(s) 105
SetI ASST 1 cut(s) 103
SfcI CTRYAG 1 cut(s) 54
SgeI CNNG 6 cut(s) 42, 48, 54, 116, 117, 212
SinI GGWCC 1 cut(s) 38
Sse9I AATT 4 cut(s) 79, 184, 207, 217
SsiI CCGC 1 cut(s) 152
SspMI CTAG 1 cut(s) 30
StyD4I CCNGG 1 cut(s) 103
TaaI ACNGT 2 cut(s) 16, 55
TasI AATT 4 cut(s) 79, 184, 207, 217
TscAI CASTG 1 cut(s) 219
TspRI CASTG 1 cut(s) 219
VpaK11BI GGWCC 1 cut(s) 38
XapI RAATTY 2 cut(s) 79, 207
XbaI TCTAGA 1 cut(s) 29
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.