RchiOBHm_Chr2g0140191

One of the components of the core complex of photosystem II (PSII), required for its stability and or assembly. PSII is a light-driven water plastoquinone oxidoreductase that uses light energy to abstract electrons from H(2)O, generating O(2) and a proton gradient subsequently used for ATP formation. It consists of a core antenna complex that captures photons, and an electron transfer chain that converts photonic excitation into a charge separation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0014290
Physical Location & Seq
Forward (+)
57542820 .. 57542987
168 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51066

Sequence Viewer

Length: 168 bp
ATGGCTACACAAACCGTTGAGGGTAGTTCTAGATCTGGCTACCCAAAACGAACTAATGTAAGGAGTTTATTGAAACCATTGAATTCAAAATATGGTAAAGTAGCTCCTAGTTGGGGAATTACTCCTTTAAAATCTAATTTTCAAAAATATTTCATTTTGATATATTAA

Protein Analysis

55

Amino Acids

6.22

Weight (kDa)

10.35

Isoelectric Point (pI)

32.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsbH PF00737 17 - 51 2.9e-10 Photosystem II 10 kDa phosphoprotein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 82
AfiI CCNNNNNNNGG 1 cut(s) 113
AgsI TTSAA 4 cut(s) 73, 82, 87, 143
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
ApoI RAATTY 1 cut(s) 82
BfaI CTAG 2 cut(s) 30, 108
BglII AGATCT 1 cut(s) 32
Bsc4I CCNNNNNNNGG 1 cut(s) 113
BseLI CCNNNNNNNGG 1 cut(s) 113
BslI CCNNNNNNNGG 1 cut(s) 113
Bsp143I GATC 1 cut(s) 32
BssMI GATC 1 cut(s) 32
Bst4CI ACNGT 1 cut(s) 16
BstKTI GATC 1 cut(s) 35
BstMBI GATC 1 cut(s) 32
BstX2I RGATCY 1 cut(s) 32
BstYI RGATCY 1 cut(s) 32
CviJI RGCY 3 cut(s) 5, 39, 104
CviKI_1 RGCY 3 cut(s) 5, 39, 104
DpnI GATC 1 cut(s) 34
DpnII GATC 1 cut(s) 32
DraI TTTAAA 1 cut(s) 129
EcoRI GAATTC 1 cut(s) 82
FaiI YATR 2 cut(s) 93, 163
FspBI CTAG 2 cut(s) 30, 108
Hpy188III TCNNGA 1 cut(s) 30
HpyCH4III ACNGT 1 cut(s) 16
Kzo9I GATC 1 cut(s) 32
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 1 cut(s) 21
MaeI CTAG 2 cut(s) 30, 108
MalI GATC 1 cut(s) 34
MboI GATC 1 cut(s) 32
MflI RGATCY 1 cut(s) 32
MluCI AATT 3 cut(s) 82, 117, 136
MnlI CCTC 1 cut(s) 13
MseI TTAA 2 cut(s) 128, 166
NdeII GATC 1 cut(s) 32
PsuI RGATCY 1 cut(s) 32
SaqAI TTAA 2 cut(s) 128, 166
Sau3AI GATC 1 cut(s) 32
SetI ASST 1 cut(s) 106
SgeI CNNG 3 cut(s) 42, 48, 120
Sse9I AATT 3 cut(s) 82, 117, 136
SspI AATATT 1 cut(s) 149
SspMI CTAG 2 cut(s) 30, 108
TaaI ACNGT 1 cut(s) 16
TasI AATT 3 cut(s) 82, 117, 136
Tru1I TTAA 2 cut(s) 128, 166
Tru9I TTAA 2 cut(s) 128, 166
TspDTI ATGAA 1 cut(s) 142
XapI RAATTY 1 cut(s) 82
XbaI TCTAGA 1 cut(s) 29
XspI CTAG 2 cut(s) 30, 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.