MD04G1032200.v1.1

One of the components of the core complex of photosystem II (PSII), required for its stability and or assembly. PSII is a light-driven water plastoquinone oxidoreductase that uses light energy to abstract electrons from H(2)O, generating O(2) and a proton gradient subsequently used for ATP formation. It consists of a core antenna complex that captures photons, and an electron transfer chain that converts photonic excitation into a charge separation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
OG0014290
Physical Location & Seq
Reverse (-)
3637086 .. 3637304
219 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1032200.v1.1.491

Sequence Viewer

Length: 219 bp
ATGGTCTTCTCAATCAAAATATATGTTCTCCCAAAACGAACTAATGCACGGAGTTCATTGAAACCATTAAATTTAGAATATGGTAAAATGGCTCTTGGATGGGGAATTACTCTTTCGATGGGTCTCACAATGATTCTATTCATGATATTCCTATTTGTTGTTTTTAAGGTTTATAATTCTTTTATTTTACCGGACGGAATTTCAATGAATTCGATTTAA

Protein Analysis

73

Amino Acids

8.18

Weight (kDa)

10.0

Isoelectric Point (pI)

23.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsbH PF00737 14 - 63 2.5e-15 Photosystem II 10 kDa phosphoprotein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 174
AcsI RAATTY 3 cut(s) 70, 198, 208
AgsI TTSAA 2 cut(s) 61, 204
Alw26I GTCTC 1 cut(s) 128
ApoI RAATTY 3 cut(s) 70, 198, 208
BccI CCATC 2 cut(s) 93, 112
BcoDI GTCTC 1 cut(s) 128
BsaI GGTCTC 1 cut(s) 128
BsaWI WCCGGW 1 cut(s) 190
BseGI GGATG 1 cut(s) 104
BsiSI CCGG 1 cut(s) 191
BsmAI GTCTC 1 cut(s) 128
Bso31I GGTCTC 1 cut(s) 128
BspHI TCATGA 1 cut(s) 141
BspTNI GGTCTC 1 cut(s) 128
BstF5I GGATG 1 cut(s) 104
BstMAI GTCTC 1 cut(s) 128
BtsCI GGATG 1 cut(s) 104
CciI TCATGA 1 cut(s) 141
CviAII CATG 1 cut(s) 142
CviJI RGCY 1 cut(s) 92
CviKI_1 RGCY 1 cut(s) 92
Eco31I GGTCTC 1 cut(s) 128
EcoRI GAATTC 1 cut(s) 208
FaeI CATG 1 cut(s) 145
FaiI YATR 5 cut(s) 22, 24, 81, 143, 174
FatI CATG 1 cut(s) 141
FokI GGATG 1 cut(s) 111
HapII CCGG 1 cut(s) 191
Hin1II CATG 1 cut(s) 145
HinfI GANTC 1 cut(s) 133
HpaII CCGG 1 cut(s) 191
Hpy188III TCNNGA 1 cut(s) 142
HpyCH4V TGCA 1 cut(s) 47
Hsp92II CATG 1 cut(s) 145
LpnPI CCDG 1 cut(s) 204
MluCI AATT 5 cut(s) 70, 105, 175, 198, 208
MseI TTAA 3 cut(s) 68, 165, 217
MspI CCGG 1 cut(s) 191
NlaIII CATG 1 cut(s) 145
PagI TCATGA 1 cut(s) 141
PfeI GAWTC 1 cut(s) 133
PsiI TTATAA 1 cut(s) 174
SaqAI TTAA 3 cut(s) 68, 165, 217
SetI ASST 1 cut(s) 171
SgeI CNNG 4 cut(s) 60, 107, 154, 203
Sse9I AATT 5 cut(s) 70, 105, 175, 198, 208
TaqI TCGA 2 cut(s) 116, 212
TasI AATT 5 cut(s) 70, 105, 175, 198, 208
TfiI GAWTC 1 cut(s) 133
Tru1I TTAA 3 cut(s) 68, 165, 217
Tru9I TTAA 3 cut(s) 68, 165, 217
TspDTI ATGAA 2 cut(s) 45, 130
TspGWI ACGGA 2 cut(s) 64, 210
XapI RAATTY 3 cut(s) 70, 198, 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.