Rh2CG305100

One of the components of the core complex of photosystem II (PSII), required for its stability and or assembly. PSII is a light-driven water plastoquinone oxidoreductase that uses light energy to abstract electrons from H(2)O, generating O(2) and a proton gradient subsequently used for ATP formation. It consists of a core antenna complex that captures photons, and an electron transfer chain that converts photonic excitation into a charge separation

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
36132579 .. 36140340
7762 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG305100.1

Sequence Viewer

Length: 339 bp
ATGGCTACACAAACCGTTGAGGGTAGTTCTAGATCTGGCCGCCCAAAACGAACTAATGCCGGAAGTTTATTCAAACCATTGAATTCAGAATATGGTAAAGTAGCTCCTGGTTGGGGAACTACTCCTTTGATGGGTCTTGAAATGGCTCTATTTGCAGAGGGTGAGAATGTCATGTCAACTAGTCAAAAGATTATTGGAGCCATAAACCCTGTAGAATCTGCCCTTGGAACCATCTGTGGTGATTTTGATGTTGATATTAGCAGGAAAATCATTTTTCATGGAAGTGAAGCAGTTGAGAGTTCAAGGAAGGCTATGTTCACTAGTTGCCTCTATGAGTAG

Protein Analysis

112

Amino Acids

11.97

Weight (kDa)

5.83

Isoelectric Point (pI)

36.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsbH PF00737 17 - 52 6.1e-17 Photosystem II 10 kDa phosphoprotein
NDK PF00334 48 - 103 1.1e-08 Nucleoside diphosphate kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 40
AcoI YGGCCR 1 cut(s) 37
AcsI RAATTY 1 cut(s) 82
AfiI CCNNNNNNNGG 2 cut(s) 113, 131
AgsI TTSAA 4 cut(s) 73, 82, 140, 303
AhlI ACTAGT 2 cut(s) 179, 320
AjnI CCWGG 1 cut(s) 106
AjuI GAANNNNNNNTTGG 2 cut(s) 207, 239
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
AoxI GGCC 1 cut(s) 37
ApoI RAATTY 1 cut(s) 82
AsuHPI GGTGA 2 cut(s) 173, 251
BccI CCATC 2 cut(s) 124, 239
BciT130I CCWGG 1 cut(s) 108
BcuI ACTAGT 2 cut(s) 179, 320
BfaI CTAG 3 cut(s) 30, 180, 321
BfmI CTRYAG 1 cut(s) 210
BglII AGATCT 1 cut(s) 32
BisI GCNGC 1 cut(s) 40
BlsI GCNGC 1 cut(s) 41
Bme1390I CCNGG 1 cut(s) 108
BmiI GGNNCC 2 cut(s) 199, 229
BmrFI CCNGG 1 cut(s) 108
BsaJI CCNNGG 1 cut(s) 223
Bsc4I CCNNNNNNNGG 2 cut(s) 113, 131
BseBI CCWGG 1 cut(s) 108
BseDI CCNNGG 1 cut(s) 223
BseLI CCNNNNNNNGG 2 cut(s) 113, 131
BshFI GGCC 1 cut(s) 39
BsiSI CCGG 1 cut(s) 60
BslI CCNNNNNNNGG 2 cut(s) 113, 131
BsnI GGCC 1 cut(s) 39
Bsp143I GATC 1 cut(s) 32
BspACI CCGC 1 cut(s) 40
BspANI GGCC 1 cut(s) 39
BspLI GGNNCC 2 cut(s) 199, 229
BssECI CCNNGG 1 cut(s) 223
BssMI GATC 1 cut(s) 32
BssT1I CCWWGG 1 cut(s) 223
Bst2UI CCWGG 1 cut(s) 108
Bst4CI ACNGT 1 cut(s) 16
BstKTI GATC 1 cut(s) 35
BstMBI GATC 1 cut(s) 32
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstNI CCWGG 1 cut(s) 108
BstSCI CCNGG 1 cut(s) 106
BstSFI CTRYAG 1 cut(s) 210
BstX2I RGATCY 1 cut(s) 32
BstYI RGATCY 1 cut(s) 32
BsuRI GGCC 1 cut(s) 39
CviAII CATG 2 cut(s) 172, 278
CviJI RGCY 6 cut(s) 5, 39, 104, 146, 200, 311
CviKI_1 RGCY 6 cut(s) 5, 39, 104, 146, 200, 311
DpnI GATC 1 cut(s) 34
DpnII GATC 1 cut(s) 32
EaeI YGGCCR 1 cut(s) 37
Eco130I CCWWGG 1 cut(s) 223
EcoRI GAATTC 1 cut(s) 82
EcoRII CCWGG 1 cut(s) 106
EcoT14I CCWWGG 1 cut(s) 223
ErhI CCWWGG 1 cut(s) 223
FaeI CATG 2 cut(s) 175, 281
FaiI YATR 6 cut(s) 93, 173, 203, 279, 314, 333
FatI CATG 2 cut(s) 171, 277
Fnu4HI GCNGC 1 cut(s) 40
Fsp4HI GCNGC 1 cut(s) 40
FspBI CTAG 3 cut(s) 30, 180, 321
GluI GCNGC 1 cut(s) 40
HaeIII GGCC 1 cut(s) 39
HapII CCGG 1 cut(s) 60
Hin1II CATG 2 cut(s) 175, 281
HincII GTYRAC 1 cut(s) 177
HindII GTYRAC 1 cut(s) 177
HinfI GANTC 1 cut(s) 215
HpaII CCGG 1 cut(s) 60
HphI GGTGA 2 cut(s) 173, 251
Hpy166II GTNNAC 2 cut(s) 177, 318
Hpy188I TCNGA 1 cut(s) 88
Hpy188III TCNNGA 2 cut(s) 30, 137
Hpy8I GTNNAC 2 cut(s) 177, 318
HpyAV CCTTC 1 cut(s) 301
HpyCH4III ACNGT 1 cut(s) 16
HpyCH4V TGCA 1 cut(s) 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
Hsp92II CATG 2 cut(s) 175, 281
Kzo9I GATC 1 cut(s) 32
LmnI GCTCC 2 cut(s) 109, 197
LpnPI CCDG 6 cut(s) 21, 73, 93, 120, 222, 247
MaeI CTAG 3 cut(s) 30, 180, 321
MalI GATC 1 cut(s) 34
MboI GATC 1 cut(s) 32
MflI RGATCY 1 cut(s) 32
MluCI AATT 1 cut(s) 82
MnlI CCTC 3 cut(s) 13, 151, 338
MslI CAYNNNNRTG 1 cut(s) 282
MspI CCGG 1 cut(s) 60
MspR9I CCNGG 1 cut(s) 108
MvaI CCWGG 1 cut(s) 108
MwoI GCNNNNNNNGC 1 cut(s) 152
NdeII GATC 1 cut(s) 32
NlaIII CATG 2 cut(s) 175, 281
NlaIV GGNNCC 2 cut(s) 199, 229
PfeI GAWTC 1 cut(s) 215
PkrI GCNGC 1 cut(s) 41
Psp6I CCWGG 1 cut(s) 106
PspGI CCWGG 1 cut(s) 106
PspN4I GGNNCC 2 cut(s) 199, 229
PsuI RGATCY 1 cut(s) 32
RseI CAYNNNNRTG 1 cut(s) 282
SatI GCNGC 1 cut(s) 40
Sau3AI GATC 1 cut(s) 32
ScrFI CCNGG 1 cut(s) 108
SetI ASST 1 cut(s) 106
SfcI CTRYAG 1 cut(s) 210
SmiMI CAYNNNNRTG 1 cut(s) 282
SpeI ACTAGT 2 cut(s) 179, 320
Sse9I AATT 1 cut(s) 82
SsiI CCGC 1 cut(s) 40
SspMI CTAG 3 cut(s) 30, 180, 321
StyD4I CCNGG 1 cut(s) 106
StyI CCWWGG 1 cut(s) 223
TaaI ACNGT 1 cut(s) 16
TasI AATT 1 cut(s) 82
TauI GCSGC 1 cut(s) 42
TfiI GAWTC 1 cut(s) 215
TspDTI ATGAA 1 cut(s) 266
XapI RAATTY 1 cut(s) 82
XbaI TCTAGA 1 cut(s) 29
XspI CTAG 3 cut(s) 30, 180, 321
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.