Prupe.7G021700_v2.0.a1

One of the components of the core complex of photosystem II (PSII), required for its stability and or assembly. PSII is a light-driven water plastoquinone oxidoreductase that uses light energy to abstract electrons from H(2)O, generating O(2) and a proton gradient subsequently used for ATP formation. It consists of a core antenna complex that captures photons, and an electron transfer chain that converts photonic excitation into a charge separation

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Reverse (-)
3308251 .. 3309184
934 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G021700.1

Sequence Viewer

Length: 225 bp
ATGGCTACACAAAACGTTGAGGGTAGTTCTAGATCTGGCCGCCCCAAACGAACTAATACAGAGAGTTTATTCAAACCATTGAATTCAGAATATGGTAAAGTAACTCCTGGGTGGGGAACTACTCCTTTGATGGGTCTCGCAATGGCTCTATTTGCAATATTCCTATCGATTATTTTGGAGATTTATAATTCTTCCATTTTACTAGATGAAATTTCAATGAATTAG

Protein Analysis

75

Amino Acids

8.11

Weight (kDa)

6.12

Isoelectric Point (pI)

39.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 186
AciI CCGC 1 cut(s) 40
AclI AACGTT 1 cut(s) 15
AcoI YGGCCR 1 cut(s) 37
AcsI RAATTY 2 cut(s) 82, 210
AfiI CCNNNNNNNGG 2 cut(s) 113, 131
AgsI TTSAA 3 cut(s) 73, 82, 216
AjnI CCWGG 1 cut(s) 106
Alw26I GTCTC 1 cut(s) 140
AoxI GGCC 1 cut(s) 37
ApoI RAATTY 2 cut(s) 82, 210
BccI CCATC 1 cut(s) 124
BciT130I CCWGG 1 cut(s) 108
BcoDI GTCTC 1 cut(s) 140
BfaI CTAG 2 cut(s) 30, 203
BglII AGATCT 1 cut(s) 32
BisI GCNGC 1 cut(s) 40
BlsI GCNGC 1 cut(s) 41
Bme1390I CCNGG 1 cut(s) 108
BmrFI CCNGG 1 cut(s) 108
Bsa29I ATCGAT 1 cut(s) 167
BsaI GGTCTC 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 107
Bsc4I CCNNNNNNNGG 2 cut(s) 113, 131
Bse3DI GCAATG 1 cut(s) 147
BseBI CCWGG 1 cut(s) 108
BseCI ATCGAT 1 cut(s) 167
BseDI CCNNGG 1 cut(s) 107
BseLI CCNNNNNNNGG 2 cut(s) 113, 131
BseMI GCAATG 1 cut(s) 147
BshFI GGCC 1 cut(s) 39
BshVI ATCGAT 1 cut(s) 167
BslI CCNNNNNNNGG 2 cut(s) 113, 131
BsmAI GTCTC 1 cut(s) 140
BsnI GGCC 1 cut(s) 39
Bso31I GGTCTC 1 cut(s) 140
Bsp143I GATC 1 cut(s) 32
BspACI CCGC 1 cut(s) 40
BspANI GGCC 1 cut(s) 39
BspDI ATCGAT 1 cut(s) 167
BspTNI GGTCTC 1 cut(s) 140
BsrDI GCAATG 1 cut(s) 147
BssECI CCNNGG 1 cut(s) 107
BssMI GATC 1 cut(s) 32
Bst2UI CCWGG 1 cut(s) 108
BstKTI GATC 1 cut(s) 35
BstMAI GTCTC 1 cut(s) 140
BstMBI GATC 1 cut(s) 32
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstNI CCWGG 1 cut(s) 108
BstSCI CCNGG 1 cut(s) 106
BstX2I RGATCY 1 cut(s) 32
BstYI RGATCY 1 cut(s) 32
Bsu15I ATCGAT 1 cut(s) 167
BsuRI GGCC 1 cut(s) 39
BsuTUI ATCGAT 1 cut(s) 167
ClaI ATCGAT 1 cut(s) 167
CviJI RGCY 3 cut(s) 5, 39, 146
CviKI_1 RGCY 3 cut(s) 5, 39, 146
DpnI GATC 1 cut(s) 34
DpnII GATC 1 cut(s) 32
EaeI YGGCCR 1 cut(s) 37
Eco31I GGTCTC 1 cut(s) 140
EcoRI GAATTC 1 cut(s) 82
EcoRII CCWGG 1 cut(s) 106
FaiI YATR 2 cut(s) 93, 186
Fnu4HI GCNGC 1 cut(s) 40
Fsp4HI GCNGC 1 cut(s) 40
FspBI CTAG 2 cut(s) 30, 203
GluI GCNGC 1 cut(s) 40
HaeIII GGCC 1 cut(s) 39
Hpy188I TCNGA 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 30
HpyCH4IV ACGT 1 cut(s) 15
HpyCH4V TGCA 1 cut(s) 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
HpySE526I ACGT 1 cut(s) 15
Kzo9I GATC 1 cut(s) 32
LpnPI CCDG 3 cut(s) 21, 93, 120
MaeI CTAG 2 cut(s) 30, 203
MaeII ACGT 1 cut(s) 15
MaeIII GTNAC 1 cut(s) 100
MalI GATC 1 cut(s) 34
MboI GATC 1 cut(s) 32
MboII GAAGA 1 cut(s) 183
MflI RGATCY 1 cut(s) 32
MluCI AATT 4 cut(s) 82, 187, 210, 220
MnlI CCTC 1 cut(s) 13
MspR9I CCNGG 1 cut(s) 108
MvaI CCWGG 1 cut(s) 108
MwoI GCNNNNNNNGC 1 cut(s) 152
NdeII GATC 1 cut(s) 32
PkrI GCNGC 1 cut(s) 41
PsiI TTATAA 1 cut(s) 186
Psp1406I AACGTT 1 cut(s) 15
Psp6I CCWGG 1 cut(s) 106
PspGI CCWGG 1 cut(s) 106
PsuI RGATCY 1 cut(s) 32
SatI GCNGC 1 cut(s) 40
Sau3AI GATC 1 cut(s) 32
ScrFI CCNGG 1 cut(s) 108
SetI ASST 1 cut(s) 18
SgeI CNNG 6 cut(s) 42, 48, 119, 120, 149, 215
Sse9I AATT 4 cut(s) 82, 187, 210, 220
SsiI CCGC 1 cut(s) 40
SspI AATATT 1 cut(s) 159
SspMI CTAG 2 cut(s) 30, 203
StyD4I CCNGG 1 cut(s) 106
TaiI ACGT 1 cut(s) 18
TaqI TCGA 1 cut(s) 167
TasI AATT 4 cut(s) 82, 187, 210, 220
TauI GCSGC 1 cut(s) 42
TspDTI ATGAA 1 cut(s) 222
XapI RAATTY 2 cut(s) 82, 210
XbaI TCTAGA 1 cut(s) 29
XspI CTAG 2 cut(s) 30, 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.