Rmu_sc0002631.1_g000006

Nucleoside diphosphate kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002631.1
Physical Location & Seq
Reverse (-)
25811 .. 26599
789 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002631.1_g000006.1.cds

Sequence Viewer

Length: 450 bp
atggcaactaatgggatgttagtagtgcctatgggaattgaaaccaatgagatgtcagtgcatatggaagaggatgagaatgtcatgtcaactagtcaaaagattattggagccacaaaccctgtagaatctgcccttggaaccatctgtggtgattttgatattgatattggcaggaaaatcagttttcatggaagtgaagcagttgagagttcaaggaaagagatggaactgtggaatcccagtcaacgcatgaatcctgatgaggctagtaaacctgaaggcattaggagacaaaatgatgacgtgggagatggagctgaaatgaagaaatggagttttcctggtccgactaggaatcccagtcaacgcaggaatcctgatgaggctaggaaacctgaagacattaggagaccacatgatgacgttggagatattttgggagattaa

Protein Analysis

149

Amino Acids

16.57

Weight (kDa)

4.72

Isoelectric Point (pI)

49.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 300, 420
AgsI TTSAA 2 cut(s) 41, 216
AhlI ACTAGT 1 cut(s) 92
AjiI CACGTC 1 cut(s) 307
AjnI CCWGG 1 cut(s) 343
AjuI GAANNNNNNNTTGG 2 cut(s) 120, 152
AluBI AGCT 1 cut(s) 320
AluI AGCT 1 cut(s) 320
Alw26I GTCTC 2 cut(s) 286, 406
AspS9I GGNCC 1 cut(s) 347
AsuHPI GGTGA 1 cut(s) 164
AvaII GGWCC 1 cut(s) 347
BbsI GAAGAC 1 cut(s) 408
BccI CCATC 3 cut(s) 152, 220, 308
BciT130I CCWGG 1 cut(s) 345
BcoDI GTCTC 2 cut(s) 286, 406
BcuI ACTAGT 1 cut(s) 92
BfaI CTAG 4 cut(s) 93, 270, 354, 390
BfmI CTRYAG 1 cut(s) 123
Bme1390I CCNGG 1 cut(s) 345
Bme18I GGWCC 1 cut(s) 347
BmgBI CACGTC 1 cut(s) 307
BmgT120I GGNCC 1 cut(s) 347
BmiI GGNNCC 2 cut(s) 112, 142
BmrFI CCNGG 1 cut(s) 345
BmrI ACTGGG 2 cut(s) 237, 357
BmuI ACTGGG 2 cut(s) 237, 357
BpiI GAAGAC 1 cut(s) 408
BsaI GGTCTC 1 cut(s) 406
BsaJI CCNNGG 1 cut(s) 136
Bse1I ACTGG 2 cut(s) 243, 363
BseBI CCWGG 1 cut(s) 345
BseDI CCNNGG 1 cut(s) 136
BseGI GGATG 2 cut(s) 21, 79
BseNI ACTGG 2 cut(s) 243, 363
BsmAI GTCTC 2 cut(s) 286, 406
Bso31I GGTCTC 1 cut(s) 406
BspLI GGNNCC 2 cut(s) 112, 142
BspTNI GGTCTC 1 cut(s) 406
BsrI ACTGG 2 cut(s) 243, 363
BssECI CCNNGG 1 cut(s) 136
BssT1I CCWWGG 1 cut(s) 136
Bst2UI CCWGG 1 cut(s) 345
Bst4CI ACNGT 1 cut(s) 234
Bst6I CTCTTC 1 cut(s) 63
BstF5I GGATG 2 cut(s) 21, 79
BstMAI GTCTC 2 cut(s) 286, 406
BstNI CCWGG 1 cut(s) 345
BstSCI CCNGG 1 cut(s) 343
BstSFI CTRYAG 1 cut(s) 123
BstV2I GAAGAC 1 cut(s) 408
BtrI CACGTC 1 cut(s) 307
BtsCI GGATG 2 cut(s) 21, 79
BtsIMutI CAGTG 1 cut(s) 63
Cfr13I GGNCC 1 cut(s) 347
CviAII CATG 4 cut(s) 85, 191, 253, 419
CviJI RGCY 4 cut(s) 113, 269, 320, 389
CviKI_1 RGCY 4 cut(s) 113, 269, 320, 389
Eam1104I CTCTTC 1 cut(s) 63
EarI CTCTTC 1 cut(s) 63
Eco130I CCWWGG 1 cut(s) 136
Eco31I GGTCTC 1 cut(s) 406
Eco47I GGWCC 1 cut(s) 347
Eco57I CTGAAG 2 cut(s) 300, 420
EcoRII CCWGG 1 cut(s) 343
EcoT14I CCWWGG 1 cut(s) 136
ErhI CCWWGG 1 cut(s) 136
FaeI CATG 4 cut(s) 88, 194, 256, 422
FaiI YATR 7 cut(s) 32, 63, 65, 86, 192, 254, 420
FatI CATG 4 cut(s) 84, 190, 252, 418
FauNDI CATATG 1 cut(s) 63
FokI GGATG 2 cut(s) 28, 86
FspBI CTAG 4 cut(s) 93, 270, 354, 390
Hin1II CATG 4 cut(s) 88, 194, 256, 422
HincII GTYRAC 3 cut(s) 90, 248, 368
HindII GTYRAC 3 cut(s) 90, 248, 368
HinfI GANTC 5 cut(s) 128, 238, 256, 358, 376
HphI GGTGA 1 cut(s) 164
Hpy166II GTNNAC 4 cut(s) 90, 248, 275, 368
Hpy188I TCNGA 1 cut(s) 351
Hpy188III TCNNGA 2 cut(s) 260, 380
Hpy8I GTNNAC 4 cut(s) 90, 248, 275, 368
HpyAV CCTTC 1 cut(s) 275
HpyCH4III ACNGT 1 cut(s) 234
HpyCH4IV ACGT 2 cut(s) 306, 426
HpyCH4V TGCA 1 cut(s) 61
HpySE526I ACGT 2 cut(s) 306, 426
Hsp92II CATG 4 cut(s) 88, 194, 256, 422
LmnI GCTCC 2 cut(s) 110, 317
MaeI CTAG 4 cut(s) 93, 270, 354, 390
MaeII ACGT 2 cut(s) 306, 426
MboII GAAGA 3 cut(s) 80, 340, 413
MluCI AATT 1 cut(s) 36
MmeI TCCRAC 2 cut(s) 374, 409
MnlI CCTC 3 cut(s) 64, 259, 379
MseI TTAA 1 cut(s) 448
MslI CAYNNNNRTG 1 cut(s) 195
MspR9I CCNGG 1 cut(s) 345
MvaI CCWGG 1 cut(s) 345
NdeI CATATG 1 cut(s) 63
NlaIII CATG 4 cut(s) 88, 194, 256, 422
NlaIV GGNNCC 2 cut(s) 112, 142
PfeI GAWTC 5 cut(s) 128, 238, 256, 358, 376
Psp6I CCWGG 1 cut(s) 343
PspGI CCWGG 1 cut(s) 343
PspN4I GGNNCC 2 cut(s) 112, 142
PspPI GGNCC 1 cut(s) 347
RseI CAYNNNNRTG 1 cut(s) 195
SaqAI TTAA 1 cut(s) 448
Sau96I GGNCC 1 cut(s) 347
ScrFI CCNGG 1 cut(s) 345
SetI ASST 5 cut(s) 280, 309, 322, 400, 429
SfcI CTRYAG 1 cut(s) 123
SinI GGWCC 1 cut(s) 347
SmiMI CAYNNNNRTG 1 cut(s) 195
SpeI ACTAGT 1 cut(s) 92
Sse9I AATT 1 cut(s) 36
SspMI CTAG 4 cut(s) 93, 270, 354, 390
StyD4I CCNGG 1 cut(s) 343
StyI CCWWGG 1 cut(s) 136
TaaI ACNGT 1 cut(s) 234
TaiI ACGT 2 cut(s) 309, 429
TasI AATT 1 cut(s) 36
TfiI GAWTC 5 cut(s) 128, 238, 256, 358, 376
Tru1I TTAA 1 cut(s) 448
Tru9I TTAA 1 cut(s) 448
TscAI CASTG 1 cut(s) 63
TspDTI ATGAA 3 cut(s) 179, 269, 341
TspRI CASTG 1 cut(s) 63
VpaK11BI GGWCC 1 cut(s) 347
XspI CTAG 4 cut(s) 93, 270, 354, 390
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.