Rh6CG170200

One of the components of the core complex of photosystem II (PSII), required for its stability and or assembly. PSII is a light-driven water plastoquinone oxidoreductase that uses light energy to abstract electrons from H(2)O, generating O(2) and a proton gradient subsequently used for ATP formation. It consists of a core antenna complex that captures photons, and an electron transfer chain that converts photonic excitation into a charge separation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0014290
Physical Location & Seq
Forward (+)
23380808 .. 23429648
48841 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG170200.1

Sequence Viewer

Length: 270 bp
ATGGCTACACAAACCGTTGAGGGTAGTTCTAGATCTGGCCGCCCAAAACGAACTAATGCTGGGAGTTTATTGAAACCATTGAATTCAGAATATGGTAAAGTAGCTCCTGGTTGGGGAACTACTCCTTTGATGGGTCTTGCAATGGCTCTATTTGCAATTAGCATTCTTAGATTATGTTTATCACCCCAATTTCTGTATCAGATTGAACAAGAATCAGAAAGTGAAAAACAAGTGAATTCCATGAAATGTAGTTCTGTAATTACCAAGTAA

Protein Analysis

89

Amino Acids

9.65

Weight (kDa)

9.39

Isoelectric Point (pI)

58.79

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsbH PF00737 17 - 53 1.1e-19 Photosystem II 10 kDa phosphoprotein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 40
AcoI YGGCCR 1 cut(s) 37
AcsI RAATTY 2 cut(s) 82, 235
AfiI CCNNNNNNNGG 2 cut(s) 113, 131
AgsI TTSAA 3 cut(s) 73, 82, 206
AjnI CCWGG 1 cut(s) 106
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
AoxI GGCC 1 cut(s) 37
ApoI RAATTY 2 cut(s) 82, 235
AsuHPI GGTGA 1 cut(s) 174
BccI CCATC 1 cut(s) 124
BciT130I CCWGG 1 cut(s) 108
BfaI CTAG 1 cut(s) 30
BglII AGATCT 1 cut(s) 32
BisI GCNGC 1 cut(s) 40
BlsI GCNGC 1 cut(s) 41
Bme1390I CCNGG 1 cut(s) 108
BmrFI CCNGG 1 cut(s) 108
Bsc4I CCNNNNNNNGG 2 cut(s) 113, 131
Bse3DI GCAATG 1 cut(s) 147
BseBI CCWGG 1 cut(s) 108
BseLI CCNNNNNNNGG 2 cut(s) 113, 131
BseMI GCAATG 1 cut(s) 147
BseYI CCCAGC 1 cut(s) 59
BshFI GGCC 1 cut(s) 39
BslI CCNNNNNNNGG 2 cut(s) 113, 131
BsmI GAATGC 1 cut(s) 162
BsnI GGCC 1 cut(s) 39
Bsp143I GATC 1 cut(s) 32
BspACI CCGC 1 cut(s) 40
BspANI GGCC 1 cut(s) 39
BsrDI GCAATG 1 cut(s) 147
BssMI GATC 1 cut(s) 32
Bst2UI CCWGG 1 cut(s) 108
Bst4CI ACNGT 1 cut(s) 16
BstDEI CTNAG 1 cut(s) 167
BstKTI GATC 1 cut(s) 35
BstMBI GATC 1 cut(s) 32
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstNI CCWGG 1 cut(s) 108
BstSCI CCNGG 1 cut(s) 106
BstX2I RGATCY 1 cut(s) 32
BstYI RGATCY 1 cut(s) 32
BsuRI GGCC 1 cut(s) 39
CviAII CATG 1 cut(s) 241
CviJI RGCY 4 cut(s) 5, 39, 104, 146
CviKI_1 RGCY 4 cut(s) 5, 39, 104, 146
DdeI CTNAG 1 cut(s) 167
DpnI GATC 1 cut(s) 34
DpnII GATC 1 cut(s) 32
EaeI YGGCCR 1 cut(s) 37
EcoRI GAATTC 2 cut(s) 82, 235
EcoRII CCWGG 1 cut(s) 106
FaeI CATG 1 cut(s) 244
FaiI YATR 3 cut(s) 93, 175, 242
FatI CATG 1 cut(s) 240
Fnu4HI GCNGC 1 cut(s) 40
Fsp4HI GCNGC 1 cut(s) 40
FspBI CTAG 1 cut(s) 30
GluI GCNGC 1 cut(s) 40
GsaI CCCAGC 1 cut(s) 63
HaeIII GGCC 1 cut(s) 39
Hin1II CATG 1 cut(s) 244
HinfI GANTC 1 cut(s) 212
HphI GGTGA 1 cut(s) 174
Hpy188I TCNGA 3 cut(s) 88, 201, 217
Hpy188III TCNNGA 1 cut(s) 30
HpyCH4III ACNGT 1 cut(s) 16
HpyCH4V TGCA 2 cut(s) 140, 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
HpyF3I CTNAG 1 cut(s) 167
Hsp92II CATG 1 cut(s) 244
Kzo9I GATC 1 cut(s) 32
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 4 cut(s) 21, 45, 93, 120
MaeI CTAG 1 cut(s) 30
MalI GATC 1 cut(s) 34
MboI GATC 1 cut(s) 32
MflI RGATCY 1 cut(s) 32
MluCI AATT 5 cut(s) 82, 156, 188, 235, 258
MnlI CCTC 1 cut(s) 13
MspR9I CCNGG 1 cut(s) 108
Mva1269I GAATGC 1 cut(s) 162
MvaI CCWGG 1 cut(s) 108
MwoI GCNNNNNNNGC 1 cut(s) 152
NdeII GATC 1 cut(s) 32
NlaIII CATG 1 cut(s) 244
PctI GAATGC 1 cut(s) 162
PfeI GAWTC 1 cut(s) 212
PkrI GCNGC 1 cut(s) 41
Psp6I CCWGG 1 cut(s) 106
PspFI CCCAGC 1 cut(s) 59
PspGI CCWGG 1 cut(s) 106
PsuI RGATCY 1 cut(s) 32
SatI GCNGC 1 cut(s) 40
Sau3AI GATC 1 cut(s) 32
ScrFI CCNGG 1 cut(s) 108
SetI ASST 1 cut(s) 106
SgeI CNNG 9 cut(s) 42, 48, 72, 119, 120, 149, 221, 242, 253
Sse9I AATT 5 cut(s) 82, 156, 188, 235, 258
SsiI CCGC 1 cut(s) 40
SspMI CTAG 1 cut(s) 30
StyD4I CCNGG 1 cut(s) 106
TaaI ACNGT 1 cut(s) 16
TasI AATT 5 cut(s) 82, 156, 188, 235, 258
TauI GCSGC 1 cut(s) 42
TfiI GAWTC 1 cut(s) 212
TspDTI ATGAA 1 cut(s) 257
XapI RAATTY 2 cut(s) 82, 235
XbaI TCTAGA 1 cut(s) 29
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.