Rroxscaffold_2G00151780

One of the components of the core complex of photosystem II (PSII), required for its stability and or assembly. PSII is a light-driven water plastoquinone oxidoreductase that uses light energy to abstract electrons from H(2)O, generating O(2) and a proton gradient subsequently used for ATP formation. It consists of a core antenna complex that captures photons, and an electron transfer chain that converts photonic excitation into a charge separation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0014290
Physical Location & Seq
Forward (+)
88944892 .. 88953770
8879 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00151780.1

Sequence Viewer

Length: 267 bp
ATGGCTACACAAACCGTTGAGGGTAGTTCTAGATCTGGCCACCCAAAACGAACTAATGCCGGGAGTTTATTGAAACCATTGAATTCAGAATATGGTAAAGTAGCTCCTGGTTGGGGAACTACTCCTTTGATGGGTCTTGCAATGACTCTATTTGCAGTATTTCTATCTATTATTTTGGAGATTTATAATTCTTCCATTTTTACTGGATGGAATTTCAATGAATTAGATTTACAAGAACCATTAACTAGCTTTTTCAATCCAAAGTGA

Protein Analysis

88

Amino Acids

9.64

Weight (kDa)

6.54

Isoelectric Point (pI)

34.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsbH PF00737 17 - 66 3.5e-29 Photosystem II 10 kDa phosphoprotein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 186
AcoI YGGCCR 1 cut(s) 37
AcsI RAATTY 2 cut(s) 82, 211
AfiI CCNNNNNNNGG 2 cut(s) 113, 131
AgsI TTSAA 4 cut(s) 73, 82, 217, 256
AjnI CCWGG 1 cut(s) 106
AluBI AGCT 2 cut(s) 104, 249
AluI AGCT 2 cut(s) 104, 249
AoxI GGCC 1 cut(s) 37
ApoI RAATTY 2 cut(s) 82, 211
AsuC2I CCSGG 1 cut(s) 61
BalI TGGCCA 1 cut(s) 39
BccI CCATC 2 cut(s) 124, 201
BciT130I CCWGG 1 cut(s) 108
BcnI CCSGG 1 cut(s) 61
BfaI CTAG 2 cut(s) 30, 246
BglII AGATCT 1 cut(s) 32
Bme1390I CCNGG 2 cut(s) 61, 108
BmrFI CCNGG 2 cut(s) 61, 108
BpuMI CCSGG 1 cut(s) 61
Bsc4I CCNNNNNNNGG 2 cut(s) 113, 131
Bse1I ACTGG 1 cut(s) 208
Bse3DI GCAATG 1 cut(s) 147
BseBI CCWGG 1 cut(s) 108
BseGI GGATG 1 cut(s) 212
BseLI CCNNNNNNNGG 2 cut(s) 113, 131
BseMI GCAATG 1 cut(s) 147
BseNI ACTGG 1 cut(s) 208
BshFI GGCC 1 cut(s) 39
BsiSI CCGG 1 cut(s) 60
BslI CCNNNNNNNGG 2 cut(s) 113, 131
BsnI GGCC 1 cut(s) 39
Bsp143I GATC 1 cut(s) 32
BspANI GGCC 1 cut(s) 39
BsrDI GCAATG 1 cut(s) 147
BsrI ACTGG 1 cut(s) 208
BssMI GATC 1 cut(s) 32
Bst2UI CCWGG 1 cut(s) 108
Bst4CI ACNGT 1 cut(s) 16
BstF5I GGATG 1 cut(s) 212
BstKTI GATC 1 cut(s) 35
BstMBI GATC 1 cut(s) 32
BstNI CCWGG 1 cut(s) 108
BstSCI CCNGG 2 cut(s) 59, 106
BstX2I RGATCY 1 cut(s) 32
BstYI RGATCY 1 cut(s) 32
BsuRI GGCC 1 cut(s) 39
BtsCI GGATG 1 cut(s) 212
CviJI RGCY 4 cut(s) 5, 39, 104, 249
CviKI_1 RGCY 4 cut(s) 5, 39, 104, 249
DpnI GATC 1 cut(s) 34
DpnII GATC 1 cut(s) 32
EaeI YGGCCR 1 cut(s) 37
EcoRI GAATTC 1 cut(s) 82
EcoRII CCWGG 1 cut(s) 106
FaiI YATR 2 cut(s) 93, 186
FokI GGATG 1 cut(s) 219
FspBI CTAG 2 cut(s) 30, 246
HaeIII GGCC 1 cut(s) 39
HapII CCGG 1 cut(s) 60
HinfI GANTC 1 cut(s) 145
HpaII CCGG 1 cut(s) 60
Hpy188I TCNGA 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 30
HpyCH4III ACNGT 1 cut(s) 16
HpyCH4V TGCA 2 cut(s) 140, 155
Kzo9I GATC 1 cut(s) 32
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 5 cut(s) 21, 73, 93, 120, 189
MaeI CTAG 2 cut(s) 30, 246
MalI GATC 1 cut(s) 34
MboI GATC 1 cut(s) 32
MboII GAAGA 1 cut(s) 183
MflI RGATCY 1 cut(s) 32
MlsI TGGCCA 1 cut(s) 39
MluCI AATT 4 cut(s) 82, 187, 211, 221
MluNI TGGCCA 1 cut(s) 39
MlyI GAGTC 1 cut(s) 139
MnlI CCTC 1 cut(s) 13
Mox20I TGGCCA 1 cut(s) 39
MscI TGGCCA 1 cut(s) 39
MseI TTAA 1 cut(s) 242
Msp20I TGGCCA 1 cut(s) 39
MspI CCGG 1 cut(s) 60
MspR9I CCNGG 2 cut(s) 61, 108
MvaI CCWGG 1 cut(s) 108
NciI CCSGG 1 cut(s) 61
NdeII GATC 1 cut(s) 32
PleI GAGTC 1 cut(s) 139
PpsI GAGTC 1 cut(s) 139
PsiI TTATAA 1 cut(s) 186
Psp6I CCWGG 1 cut(s) 106
PspGI CCWGG 1 cut(s) 106
PsuI RGATCY 1 cut(s) 32
SaqAI TTAA 1 cut(s) 242
Sau3AI GATC 1 cut(s) 32
SchI GAGTC 1 cut(s) 139
ScrFI CCNGG 2 cut(s) 61, 108
SetI ASST 2 cut(s) 106, 251
Sse9I AATT 4 cut(s) 82, 187, 211, 221
SspMI CTAG 2 cut(s) 30, 246
StyD4I CCNGG 2 cut(s) 59, 106
TaaI ACNGT 1 cut(s) 16
TasI AATT 4 cut(s) 82, 187, 211, 221
Tru1I TTAA 1 cut(s) 242
Tru9I TTAA 1 cut(s) 242
TspDTI ATGAA 1 cut(s) 234
XapI RAATTY 2 cut(s) 82, 211
XbaI TCTAGA 1 cut(s) 29
XspI CTAG 2 cut(s) 30, 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.