RCHIOBHM_CPG0501961

One of the components of the core complex of photosystem II (PSII), required for its stability and or assembly. PSII is a light-driven water plastoquinone oxidoreductase that uses light energy to abstract electrons from H(2)O, generating O(2) and a proton gradient subsequently used for ATP formation. It consists of a core antenna complex that captures photons, and an electron transfer chain that converts photonic excitation into a charge separation

Basic Information

Type: gene
Biological Identity
rosa_chinensis
Pt
Physical Location & Seq
Reverse (-)
36307 .. 37252
946 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ15686

Sequence Viewer

Length: 225 bp
ATGGCTACACAAACCGTTGAGGGTAGTTCTAGATCTGGCCGCCCAAAACGAACTAATGCCGGGAGTTTATTGAAACCATTGAATTCAGAATATGGTAAAGTAGCTCCTGGTTGGGGAACTACTCCTTTGATGGGTCTTGCAATGGCTCTATTTGCAGTATTTCTATCTATTATTTTGGAGATTTATAATTCTTCCATTTTACTGGATGGAATTTCAATGAATTAG

Protein Analysis

74

Amino Acids

7.85

Weight (kDa)

9.4

Isoelectric Point (pI)

36.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PsbH PF00737 17 - 68 1.1e-30 Photosystem II 10 kDa phosphoprotein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 186
AciI CCGC 1 cut(s) 40
AcoI YGGCCR 1 cut(s) 37
AcsI RAATTY 2 cut(s) 82, 210
AfiI CCNNNNNNNGG 2 cut(s) 113, 131
AgsI TTSAA 3 cut(s) 73, 82, 216
AjnI CCWGG 1 cut(s) 106
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
AoxI GGCC 1 cut(s) 37
ApoI RAATTY 2 cut(s) 82, 210
AsuC2I CCSGG 1 cut(s) 61
BccI CCATC 2 cut(s) 124, 200
BciT130I CCWGG 1 cut(s) 108
BcnI CCSGG 1 cut(s) 61
BfaI CTAG 1 cut(s) 30
BglII AGATCT 1 cut(s) 32
BisI GCNGC 1 cut(s) 40
BlsI GCNGC 1 cut(s) 41
Bme1390I CCNGG 2 cut(s) 61, 108
BmrFI CCNGG 2 cut(s) 61, 108
BpuMI CCSGG 1 cut(s) 61
Bsc4I CCNNNNNNNGG 2 cut(s) 113, 131
Bse1I ACTGG 1 cut(s) 207
Bse3DI GCAATG 1 cut(s) 147
BseBI CCWGG 1 cut(s) 108
BseGI GGATG 1 cut(s) 211
BseLI CCNNNNNNNGG 2 cut(s) 113, 131
BseMI GCAATG 1 cut(s) 147
BseNI ACTGG 1 cut(s) 207
BshFI GGCC 1 cut(s) 39
BsiSI CCGG 1 cut(s) 60
BslI CCNNNNNNNGG 2 cut(s) 113, 131
BsnI GGCC 1 cut(s) 39
Bsp143I GATC 1 cut(s) 32
BspACI CCGC 1 cut(s) 40
BspANI GGCC 1 cut(s) 39
BsrDI GCAATG 1 cut(s) 147
BsrI ACTGG 1 cut(s) 207
BssMI GATC 1 cut(s) 32
Bst2UI CCWGG 1 cut(s) 108
Bst4CI ACNGT 1 cut(s) 16
BstF5I GGATG 1 cut(s) 211
BstKTI GATC 1 cut(s) 35
BstMBI GATC 1 cut(s) 32
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstNI CCWGG 1 cut(s) 108
BstSCI CCNGG 2 cut(s) 59, 106
BstX2I RGATCY 1 cut(s) 32
BstXI CCANNNNNNTGG 1 cut(s) 202
BstYI RGATCY 1 cut(s) 32
BsuRI GGCC 1 cut(s) 39
BtsCI GGATG 1 cut(s) 211
CviJI RGCY 4 cut(s) 5, 39, 104, 146
CviKI_1 RGCY 4 cut(s) 5, 39, 104, 146
DpnI GATC 1 cut(s) 34
DpnII GATC 1 cut(s) 32
EaeI YGGCCR 1 cut(s) 37
EcoRI GAATTC 1 cut(s) 82
EcoRII CCWGG 1 cut(s) 106
FaiI YATR 2 cut(s) 93, 186
Fnu4HI GCNGC 1 cut(s) 40
FokI GGATG 1 cut(s) 218
Fsp4HI GCNGC 1 cut(s) 40
FspBI CTAG 1 cut(s) 30
GluI GCNGC 1 cut(s) 40
HaeIII GGCC 1 cut(s) 39
HapII CCGG 1 cut(s) 60
HpaII CCGG 1 cut(s) 60
Hpy188I TCNGA 1 cut(s) 88
Hpy188III TCNNGA 1 cut(s) 30
HpyCH4III ACNGT 1 cut(s) 16
HpyCH4V TGCA 2 cut(s) 140, 155
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
Kzo9I GATC 1 cut(s) 32
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 5 cut(s) 21, 73, 93, 120, 188
MaeI CTAG 1 cut(s) 30
MalI GATC 1 cut(s) 34
MboI GATC 1 cut(s) 32
MboII GAAGA 1 cut(s) 183
MflI RGATCY 1 cut(s) 32
MluCI AATT 4 cut(s) 82, 187, 210, 220
MnlI CCTC 1 cut(s) 13
MspI CCGG 1 cut(s) 60
MspR9I CCNGG 2 cut(s) 61, 108
MvaI CCWGG 1 cut(s) 108
MwoI GCNNNNNNNGC 1 cut(s) 152
NciI CCSGG 1 cut(s) 61
NdeII GATC 1 cut(s) 32
PkrI GCNGC 1 cut(s) 41
PsiI TTATAA 1 cut(s) 186
Psp6I CCWGG 1 cut(s) 106
PspGI CCWGG 1 cut(s) 106
PsuI RGATCY 1 cut(s) 32
SatI GCNGC 1 cut(s) 40
Sau3AI GATC 1 cut(s) 32
ScrFI CCNGG 2 cut(s) 61, 108
SetI ASST 1 cut(s) 106
SgeI CNNG 8 cut(s) 42, 48, 72, 73, 119, 120, 149, 215
Sse9I AATT 4 cut(s) 82, 187, 210, 220
SsiI CCGC 1 cut(s) 40
SspMI CTAG 1 cut(s) 30
StyD4I CCNGG 2 cut(s) 59, 106
TaaI ACNGT 1 cut(s) 16
TasI AATT 4 cut(s) 82, 187, 210, 220
TauI GCSGC 1 cut(s) 42
XapI RAATTY 2 cut(s) 82, 210
XbaI TCTAGA 1 cut(s) 29
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.