FvH4_1g10750

40S ribosomal protein S30

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb1
Physical Location & Seq
Reverse (-)
5871926 .. 5872998
1073 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_1g10750.t1

Sequence Viewer

Length: 189 bp
ATGGGAAAGGTTCATGGATCTTTGGCTCGTGCTGGTAAGGTGAGAGGCCAAACCCCAAAGGTGGCCAAGCAGGACAAGAAGAAGAAGCCCCGTGGACGCGCCCACAAGCGCATGCAATACAATCGCCGTTTCGTCACCGCTGTGGTTGGCTTTGGCAAGAAGAGAGGACCCAACTCATCTGAGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

6.93

Weight (kDa)

12.0

Isoelectric Point (pI)

22.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S30 PF04758 3 - 59 8.9e-31 Ribosomal protein S30
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 99
AciI CCGC 1 cut(s) 138
AclWI GGATC 1 cut(s) 25
AcoI YGGCCR 1 cut(s) 63
AfiI CCNNNNNNNGG 1 cut(s) 61
AleI CACNNNNGTG 1 cut(s) 140
AlwI GGATC 1 cut(s) 25
AoxI GGCC 2 cut(s) 46, 63
AspLEI GCGC 2 cut(s) 101, 111
AspS9I GGNCC 1 cut(s) 167
AsuHPI GGTGA 2 cut(s) 52, 127
AvaII GGWCC 1 cut(s) 167
BalI TGGCCA 1 cut(s) 65
BauI CACGAG 1 cut(s) 27
BceAI ACGGC 1 cut(s) 111
BcgI CGANNNNNNTGC 2 cut(s) 104, 138
Bme18I GGWCC 1 cut(s) 167
BmgT120I GGNCC 1 cut(s) 167
BmiI GGNNCC 1 cut(s) 169
BsaJI CCNNGG 1 cut(s) 91
Bsc4I CCNNNNNNNGG 1 cut(s) 61
BseDI CCNNGG 1 cut(s) 91
BseLI CCNNNNNNNGG 1 cut(s) 61
BseMII CTCAG 1 cut(s) 171
Bsh1236I CGCG 1 cut(s) 99
BshFI GGCC 2 cut(s) 48, 65
BslI CCNNNNNNNGG 1 cut(s) 61
BsnI GGCC 2 cut(s) 48, 65
Bsp143I GATC 1 cut(s) 17
BspACI CCGC 1 cut(s) 138
BspANI GGCC 2 cut(s) 48, 65
BspCNI CTCAG 1 cut(s) 172
BspFNI CGCG 1 cut(s) 99
BspLI GGNNCC 1 cut(s) 169
BspPI GGATC 1 cut(s) 25
BssECI CCNNGG 1 cut(s) 91
BssMI GATC 1 cut(s) 17
BssSI CACGAG 1 cut(s) 27
Bst2BI CACGAG 1 cut(s) 27
Bst6I CTCTTC 1 cut(s) 155
BstC8I GCNNGC 1 cut(s) 113
BstDEI CTNAG 1 cut(s) 180
BstDSI CCRYGG 1 cut(s) 91
BstFNI CGCG 1 cut(s) 99
BstHHI GCGC 2 cut(s) 101, 111
BstKTI GATC 1 cut(s) 20
BstMBI GATC 1 cut(s) 17
BstNSI RCATGY 1 cut(s) 115
BstUI CGCG 1 cut(s) 99
BstX2I RGATCY 1 cut(s) 17
BstYI RGATCY 1 cut(s) 17
BsuRI GGCC 2 cut(s) 48, 65
BtgI CCRYGG 1 cut(s) 91
Cac8I GCNNGC 1 cut(s) 113
CfoI GCGC 2 cut(s) 101, 111
Cfr13I GGNCC 1 cut(s) 167
CseI GACGC 1 cut(s) 105
CviAII CATG 2 cut(s) 14, 112
CviJI RGCY 5 cut(s) 26, 48, 65, 88, 150
CviKI_1 RGCY 5 cut(s) 26, 48, 65, 88, 150
DdeI CTNAG 1 cut(s) 180
DpnI GATC 1 cut(s) 19
DpnII GATC 1 cut(s) 17
EaeI YGGCCR 1 cut(s) 63
Eam1104I CTCTTC 1 cut(s) 155
EarI CTCTTC 1 cut(s) 155
Eco47I GGWCC 1 cut(s) 167
EcoO109I RGGNCCY 1 cut(s) 167
FaeI CATG 2 cut(s) 17, 115
FaiI YATR 2 cut(s) 15, 113
FatI CATG 2 cut(s) 13, 111
GlaI GCGC 2 cut(s) 100, 110
HaeIII GGCC 2 cut(s) 48, 65
HgaI GACGC 1 cut(s) 105
HhaI GCGC 2 cut(s) 101, 111
Hin1II CATG 2 cut(s) 17, 115
Hin6I GCGC 2 cut(s) 99, 109
HinP1I GCGC 2 cut(s) 99, 109
HphI GGTGA 2 cut(s) 52, 127
Hpy166II GTNNAC 1 cut(s) 95
Hpy188I TCNGA 1 cut(s) 181
Hpy8I GTNNAC 1 cut(s) 95
HpyCH4V TGCA 1 cut(s) 115
HpyF3I CTNAG 1 cut(s) 180
Hsp92II CATG 2 cut(s) 17, 115
HspAI GCGC 2 cut(s) 99, 109
Kzo9I GATC 1 cut(s) 17
LpnPI CCDG 2 cut(s) 18, 56
MaeIII GTNAC 1 cut(s) 133
MalI GATC 1 cut(s) 19
MboI GATC 1 cut(s) 17
MboII GAAGA 3 cut(s) 91, 94, 172
MflI RGATCY 1 cut(s) 17
MlsI TGGCCA 1 cut(s) 65
MluNI TGGCCA 1 cut(s) 65
MnlI CCTC 2 cut(s) 38, 158
Mox20I TGGCCA 1 cut(s) 65
MscI TGGCCA 1 cut(s) 65
MslI CAYNNNNRTG 1 cut(s) 140
Msp20I TGGCCA 1 cut(s) 65
MspA1I CMGCKG 1 cut(s) 140
MvnI CGCG 1 cut(s) 99
NdeII GATC 1 cut(s) 17
NlaIII CATG 2 cut(s) 17, 115
NlaIV GGNNCC 1 cut(s) 169
NmuCI GTSAC 1 cut(s) 133
NspI RCATGY 1 cut(s) 115
OliI CACNNNNGTG 1 cut(s) 140
PaeI GCATGC 1 cut(s) 115
PpuMI RGGWCCY 1 cut(s) 167
Psp5II RGGWCCY 1 cut(s) 167
PspN4I GGNNCC 1 cut(s) 169
PspPI GGNCC 1 cut(s) 167
PspPPI RGGWCCY 1 cut(s) 167
PsuI RGATCY 1 cut(s) 17
RseI CAYNNNNRTG 1 cut(s) 140
Sau3AI GATC 1 cut(s) 17
Sau96I GGNCC 1 cut(s) 167
SetI ASST 3 cut(s) 12, 42, 63
SinI GGWCC 1 cut(s) 167
SmiMI CAYNNNNRTG 1 cut(s) 140
SphI GCATGC 1 cut(s) 115
SsiI CCGC 1 cut(s) 138
TseFI GTSAC 1 cut(s) 133
Tsp45I GTSAC 1 cut(s) 133
VpaK11BI GGWCC 1 cut(s) 167
XceI RCATGY 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.