Rh2AG116100

Ribosomal protein S30

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
10402361 .. 10403584
1224 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG116100.1

Sequence Viewer

Length: 162 bp
ATGGGAAAGGTTCATGGTTCTTTGGCTCGTGCTGGTAAGGTGAGAGGCCAAACCCCAAAGGTGGCCAAGCAGGACAAGAAGAAGAAGCCCCGTGGACGCGCCCACAAGCGCATGCAATACAATCGCCGTTTCGTCACCGCTGGTACTACCATCTTATTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

5.99

Weight (kDa)

12.0

Isoelectric Point (pI)

17.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S30 PF04758 3 - 47 7.9e-27 Ribosomal protein S30
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 99
AciI CCGC 1 cut(s) 138
AcoI YGGCCR 1 cut(s) 63
AfaI GTAC 1 cut(s) 145
AfiI CCNNNNNNNGG 1 cut(s) 61
AoxI GGCC 2 cut(s) 46, 63
AspLEI GCGC 2 cut(s) 101, 111
AsuHPI GGTGA 2 cut(s) 52, 127
BalI TGGCCA 1 cut(s) 65
BauI CACGAG 1 cut(s) 27
BccI CCATC 1 cut(s) 158
BceAI ACGGC 1 cut(s) 111
BcgI CGANNNNNNTGC 2 cut(s) 104, 138
BsaJI CCNNGG 1 cut(s) 91
Bsc4I CCNNNNNNNGG 1 cut(s) 61
BseDI CCNNGG 1 cut(s) 91
BseLI CCNNNNNNNGG 1 cut(s) 61
Bsh1236I CGCG 1 cut(s) 99
BshFI GGCC 2 cut(s) 48, 65
BslI CCNNNNNNNGG 1 cut(s) 61
BsnI GGCC 2 cut(s) 48, 65
BspACI CCGC 1 cut(s) 138
BspANI GGCC 2 cut(s) 48, 65
BspFNI CGCG 1 cut(s) 99
BssECI CCNNGG 1 cut(s) 91
BssSI CACGAG 1 cut(s) 27
Bst2BI CACGAG 1 cut(s) 27
BstC8I GCNNGC 1 cut(s) 113
BstDSI CCRYGG 1 cut(s) 91
BstFNI CGCG 1 cut(s) 99
BstHHI GCGC 2 cut(s) 101, 111
BstNSI RCATGY 1 cut(s) 115
BstUI CGCG 1 cut(s) 99
BsuRI GGCC 2 cut(s) 48, 65
BtgI CCRYGG 1 cut(s) 91
Cac8I GCNNGC 1 cut(s) 113
CfoI GCGC 2 cut(s) 101, 111
CseI GACGC 1 cut(s) 105
Csp6I GTAC 1 cut(s) 144
CviAII CATG 2 cut(s) 14, 112
CviJI RGCY 4 cut(s) 26, 48, 65, 88
CviKI_1 RGCY 4 cut(s) 26, 48, 65, 88
CviQI GTAC 1 cut(s) 144
EaeI YGGCCR 1 cut(s) 63
FaeI CATG 2 cut(s) 17, 115
FaiI YATR 2 cut(s) 15, 113
FatI CATG 2 cut(s) 13, 111
GlaI GCGC 2 cut(s) 100, 110
HaeIII GGCC 2 cut(s) 48, 65
HgaI GACGC 1 cut(s) 105
HhaI GCGC 2 cut(s) 101, 111
Hin1II CATG 2 cut(s) 17, 115
Hin6I GCGC 2 cut(s) 99, 109
HinP1I GCGC 2 cut(s) 99, 109
HphI GGTGA 2 cut(s) 52, 127
Hpy166II GTNNAC 1 cut(s) 95
Hpy188I TCNGA 1 cut(s) 161
Hpy8I GTNNAC 1 cut(s) 95
HpyCH4V TGCA 1 cut(s) 115
Hsp92II CATG 2 cut(s) 17, 115
HspAI GCGC 2 cut(s) 99, 109
LpnPI CCDG 3 cut(s) 18, 56, 126
MaeIII GTNAC 1 cut(s) 133
MboII GAAGA 2 cut(s) 91, 94
MlsI TGGCCA 1 cut(s) 65
MluNI TGGCCA 1 cut(s) 65
MnlI CCTC 1 cut(s) 38
Mox20I TGGCCA 1 cut(s) 65
MscI TGGCCA 1 cut(s) 65
Msp20I TGGCCA 1 cut(s) 65
MspA1I CMGCKG 1 cut(s) 140
MvnI CGCG 1 cut(s) 99
NlaIII CATG 2 cut(s) 17, 115
NmuCI GTSAC 1 cut(s) 133
NspI RCATGY 1 cut(s) 115
PaeI GCATGC 1 cut(s) 115
RsaI GTAC 1 cut(s) 145
RsaNI GTAC 1 cut(s) 144
SetI ASST 3 cut(s) 12, 42, 63
SphI GCATGC 1 cut(s) 115
SsiI CCGC 1 cut(s) 138
TseFI GTSAC 1 cut(s) 133
Tsp45I GTSAC 1 cut(s) 133
XceI RCATGY 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.